Incidental Mutation 'R6671:Bcl9l'
List |< first << previous [record 50 of 686] next >> last >|
ID527142
Institutional Source Beutler Lab
Gene Symbol Bcl9l
Ensembl Gene ENSMUSG00000063382
Gene NameB cell CLL/lymphoma 9-like
SynonymsDLNB11
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R6671 (G1)
Quality Score210.468
Status Not validated
Chromosome9
Chromosomal Location44482825-44511896 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GAACAT to GAACATAAACAT at 44507074 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062215] [ENSMUST00000074989] [ENSMUST00000179828] [ENSMUST00000215293] [ENSMUST00000218183] [ENSMUST00000220303]
Predicted Effect probably benign
Transcript: ENSMUST00000062215
SMART Domains Protein: ENSMUSP00000050444
Gene: ENSMUSG00000047880

DomainStartEndE-ValueType
Pfam:7tm_1 70 324 8.9e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074989
SMART Domains Protein: ENSMUSP00000074516
Gene: ENSMUSG00000063382

DomainStartEndE-ValueType
low complexity region 215 234 N/A INTRINSIC
PDB:2XB1|C 236 269 2e-14 PDB
low complexity region 278 292 N/A INTRINSIC
low complexity region 297 325 N/A INTRINSIC
low complexity region 337 376 N/A INTRINSIC
Pfam:BCL9 395 432 2.4e-18 PFAM
low complexity region 490 507 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 590 602 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179828
SMART Domains Protein: ENSMUSP00000137518
Gene: ENSMUSG00000047880

DomainStartEndE-ValueType
Pfam:7tm_1 70 324 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215293
Predicted Effect probably benign
Transcript: ENSMUST00000218183
Predicted Effect probably benign
Transcript: ENSMUST00000220303
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik T C 6: 131,551,350 probably null Het
Abce1 A G 8: 79,689,177 V404A probably benign Het
Cpd T A 11: 76,795,533 I990F probably damaging Het
Ddhd1 CA C 14: 45,657,232 probably null Het
Dnajb6 A G 5: 29,748,420 E17G probably damaging Het
Fastk T C 5: 24,441,609 D308G probably damaging Het
Fkbp14 A G 6: 54,579,677 Y69H probably damaging Het
Gldn T C 9: 54,338,407 L414P probably damaging Het
Glmn T A 5: 107,549,414 M487L probably benign Het
Gm3404 C A 5: 146,527,677 R163S probably benign Het
Gucy1b1 T C 3: 82,034,408 T575A probably benign Het
Hydin T A 8: 110,601,318 V4819D probably damaging Het
Ikbip A G 10: 91,096,607 probably null Het
Mertk G T 2: 128,752,023 probably null Het
Mfsd1 T C 3: 67,585,662 V93A possibly damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Myo3a A T 2: 22,294,522 N269Y probably damaging Het
Nisch A T 14: 31,204,463 probably benign Het
Otof A G 5: 30,419,533 V125A probably benign Het
Pla2g4a A G 1: 149,887,631 I93T probably benign Het
Prrc2c A G 1: 162,697,585 I484T probably damaging Het
Qrich1 T A 9: 108,533,786 I170N probably benign Het
Rb1 A T 14: 73,197,266 M904K probably damaging Het
Rgs11 A T 17: 26,208,298 K399M probably damaging Het
Tmprss13 C T 9: 45,343,231 T432M probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Vps53 A G 11: 76,134,506 Y171H probably damaging Het
Zbtb8b C T 4: 129,427,784 R395Q probably damaging Het
Zfp81 A T 17: 33,335,439 C134S probably benign Het
Zranb1 A G 7: 132,971,313 D403G probably damaging Het
Other mutations in Bcl9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Bcl9l APN 9 44505627 missense possibly damaging 0.86
IGL00969:Bcl9l APN 9 44508242 missense possibly damaging 0.79
IGL01011:Bcl9l APN 9 44505179 missense possibly damaging 0.85
IGL01396:Bcl9l APN 9 44506824 missense probably damaging 0.99
IGL02015:Bcl9l APN 9 44508801 unclassified probably null
IGL02106:Bcl9l APN 9 44509199 missense probably benign 0.03
IGL02310:Bcl9l APN 9 44509305 missense probably damaging 1.00
IGL02447:Bcl9l APN 9 44507334 missense probably benign 0.09
IGL02534:Bcl9l APN 9 44505739 missense probably benign 0.00
IGL02541:Bcl9l APN 9 44507769 missense probably benign 0.02
IGL02688:Bcl9l APN 9 44505263 missense possibly damaging 0.86
IGL02931:Bcl9l APN 9 44500750 missense probably damaging 0.96
R0098:Bcl9l UTSW 9 44505617 missense probably benign
R0142:Bcl9l UTSW 9 44507112 missense probably benign 0.09
R0193:Bcl9l UTSW 9 44507406 missense probably damaging 1.00
R0227:Bcl9l UTSW 9 44505236 missense possibly damaging 0.96
R0481:Bcl9l UTSW 9 44506682 missense probably benign
R0496:Bcl9l UTSW 9 44509518 missense probably benign 0.00
R1741:Bcl9l UTSW 9 44509689 missense probably damaging 0.99
R1971:Bcl9l UTSW 9 44508699 unclassified probably null
R1976:Bcl9l UTSW 9 44506152 missense possibly damaging 0.76
R4415:Bcl9l UTSW 9 44501879 missense possibly damaging 0.83
R4751:Bcl9l UTSW 9 44506803 missense probably damaging 0.99
R4810:Bcl9l UTSW 9 44508353 missense probably damaging 1.00
R4880:Bcl9l UTSW 9 44508710 missense probably benign 0.01
R4967:Bcl9l UTSW 9 44505068 missense possibly damaging 0.85
R5418:Bcl9l UTSW 9 44505436 missense possibly damaging 0.53
R5572:Bcl9l UTSW 9 44500798 missense possibly damaging 0.66
R5658:Bcl9l UTSW 9 44509169 missense probably damaging 1.00
R5812:Bcl9l UTSW 9 44506644 missense probably benign 0.01
R6515:Bcl9l UTSW 9 44507874 splice site probably null
R6670:Bcl9l UTSW 9 44507072 small insertion probably benign
R6670:Bcl9l UTSW 9 44507085 small insertion probably benign
R6671:Bcl9l UTSW 9 44507072 small insertion probably benign
R6682:Bcl9l UTSW 9 44501103 missense possibly damaging 0.91
R6966:Bcl9l UTSW 9 44509388 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAACGGATGATACAGGCTC -3'
(R):5'- AACTGTGAAGGCATGAGCATC -3'

Sequencing Primer
(F):5'- CGGATGATACAGGCTCATCGAC -3'
(R):5'- TGAAGGCATGAGCATCTTCTG -3'
Posted On2018-07-23