Incidental Mutation 'R6672:Dhx36'
ID 527161
Institutional Source Beutler Lab
Gene Symbol Dhx36
Ensembl Gene ENSMUSG00000027770
Gene Name DEAH-box helicase 36
Synonyms 2810407E23Rik, Ddx36, RHAU
MMRRC Submission 044792-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6672 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 62375434-62414425 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62402957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 265 (V265A)
Ref Sequence ENSEMBL: ENSMUSP00000029336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029336]
AlphaFold Q8VHK9
Predicted Effect probably damaging
Transcript: ENSMUST00000029336
AA Change: V265A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029336
Gene: ENSMUSG00000027770
AA Change: V265A

DomainStartEndE-ValueType
low complexity region 10 45 N/A INTRINSIC
DEXDc 198 389 1.53e-31 SMART
HELICc 495 600 5.61e-16 SMART
HA2 662 753 2.23e-26 SMART
Pfam:OB_NTP_bind 792 910 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192223
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality around E7.0. Mice homozygous for a conditional allele activated in the hematopoiesis systemexhibit impaired erythropoiesis associated with cell cycle defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actmap C T 7: 26,903,489 (GRCm39) probably benign Het
Adam24 A G 8: 41,134,572 (GRCm39) E680G probably benign Het
Adam7 T A 14: 68,742,151 (GRCm39) probably null Het
Arid2 C T 15: 96,260,226 (GRCm39) T351I probably benign Het
Asz1 T A 6: 18,075,817 (GRCm39) E252V possibly damaging Het
Chrm5 C T 2: 112,310,141 (GRCm39) C325Y probably benign Het
Cimap1a A G 7: 140,428,340 (GRCm39) S25G probably benign Het
Cyp2c65 A G 19: 39,076,118 (GRCm39) R357G probably damaging Het
Dip2c G A 13: 9,617,866 (GRCm39) probably null Het
Dock10 A T 1: 80,490,248 (GRCm39) M1958K probably benign Het
Dpf1 T C 7: 29,015,693 (GRCm39) C357R probably damaging Het
Dync1h1 C T 12: 110,624,568 (GRCm39) R3703C probably damaging Het
Eef1g A G 19: 8,944,411 (GRCm39) probably null Het
Gnl2 T C 4: 124,942,186 (GRCm39) V397A probably damaging Het
Gramd2b A G 18: 56,565,408 (GRCm39) E21G possibly damaging Het
Grik3 C A 4: 125,517,309 (GRCm39) Q51K probably benign Het
Hectd2 G T 19: 36,564,780 (GRCm39) Q20H probably damaging Het
Krtap5-1 A G 7: 141,850,233 (GRCm39) C192R unknown Het
Lrpap1 A T 5: 35,256,577 (GRCm39) M135K probably benign Het
Lrrc9 G A 12: 72,520,710 (GRCm39) R664H possibly damaging Het
Mef2c T G 13: 83,800,975 (GRCm39) V225G probably damaging Het
Nlrp9b T C 7: 19,753,263 (GRCm39) L56P probably damaging Het
Nup133 T C 8: 124,643,020 (GRCm39) probably null Het
Or12j4 G A 7: 140,046,648 (GRCm39) C178Y probably damaging Het
Or5ak23 T A 2: 85,244,948 (GRCm39) I92L possibly damaging Het
Ppp1r3d T C 2: 178,055,552 (GRCm39) E150G possibly damaging Het
Smpd1 A G 7: 105,204,480 (GRCm39) M120V probably benign Het
Zbtb46 A G 2: 181,053,629 (GRCm39) L361P probably benign Het
Zfp605 A G 5: 110,275,863 (GRCm39) H327R probably damaging Het
Other mutations in Dhx36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dhx36 APN 3 62,377,979 (GRCm39) utr 3 prime probably benign
IGL00538:Dhx36 APN 3 62,408,466 (GRCm39) missense probably benign 0.04
IGL00706:Dhx36 APN 3 62,404,263 (GRCm39) missense probably damaging 1.00
IGL02040:Dhx36 APN 3 62,408,436 (GRCm39) missense probably benign
IGL02141:Dhx36 APN 3 62,401,310 (GRCm39) missense probably benign 0.25
IGL02514:Dhx36 APN 3 62,408,319 (GRCm39) missense possibly damaging 0.63
IGL02540:Dhx36 APN 3 62,414,309 (GRCm39) missense probably benign 0.07
IGL02629:Dhx36 APN 3 62,414,155 (GRCm39) missense probably benign 0.01
IGL02858:Dhx36 APN 3 62,384,797 (GRCm39) splice site probably benign
IGL03305:Dhx36 APN 3 62,408,257 (GRCm39) nonsense probably null
bundeswehr UTSW 3 62,386,747 (GRCm39) missense probably benign
R0002:Dhx36 UTSW 3 62,388,260 (GRCm39) missense probably damaging 1.00
R0002:Dhx36 UTSW 3 62,388,260 (GRCm39) missense probably damaging 1.00
R0021:Dhx36 UTSW 3 62,385,016 (GRCm39) missense possibly damaging 0.66
R0021:Dhx36 UTSW 3 62,385,016 (GRCm39) missense possibly damaging 0.66
R0671:Dhx36 UTSW 3 62,401,162 (GRCm39) missense possibly damaging 0.96
R0735:Dhx36 UTSW 3 62,380,150 (GRCm39) missense probably benign 0.00
R0782:Dhx36 UTSW 3 62,414,135 (GRCm39) splice site probably benign
R1725:Dhx36 UTSW 3 62,414,360 (GRCm39) start codon destroyed probably benign 0.01
R1951:Dhx36 UTSW 3 62,391,694 (GRCm39) missense probably damaging 0.99
R1959:Dhx36 UTSW 3 62,386,806 (GRCm39) missense probably benign 0.01
R2257:Dhx36 UTSW 3 62,385,064 (GRCm39) missense probably damaging 1.00
R2397:Dhx36 UTSW 3 62,405,518 (GRCm39) missense probably benign 0.00
R2484:Dhx36 UTSW 3 62,380,236 (GRCm39) missense probably damaging 0.96
R2973:Dhx36 UTSW 3 62,402,919 (GRCm39) missense possibly damaging 0.56
R2973:Dhx36 UTSW 3 62,402,916 (GRCm39) missense probably benign 0.00
R3617:Dhx36 UTSW 3 62,394,481 (GRCm39) missense probably benign 0.01
R3617:Dhx36 UTSW 3 62,379,428 (GRCm39) missense possibly damaging 0.96
R3725:Dhx36 UTSW 3 62,395,643 (GRCm39) splice site probably benign
R3898:Dhx36 UTSW 3 62,399,790 (GRCm39) missense probably damaging 0.98
R4332:Dhx36 UTSW 3 62,392,412 (GRCm39) missense probably damaging 1.00
R4359:Dhx36 UTSW 3 62,382,699 (GRCm39) missense probably benign 0.05
R4493:Dhx36 UTSW 3 62,395,925 (GRCm39) intron probably benign
R4652:Dhx36 UTSW 3 62,408,419 (GRCm39) missense probably benign 0.01
R4866:Dhx36 UTSW 3 62,380,198 (GRCm39) missense probably damaging 1.00
R4884:Dhx36 UTSW 3 62,391,681 (GRCm39) missense probably damaging 1.00
R4960:Dhx36 UTSW 3 62,404,280 (GRCm39) missense probably damaging 1.00
R5083:Dhx36 UTSW 3 62,379,420 (GRCm39) missense probably benign 0.17
R5162:Dhx36 UTSW 3 62,401,201 (GRCm39) missense probably damaging 1.00
R5815:Dhx36 UTSW 3 62,401,176 (GRCm39) missense probably damaging 1.00
R6090:Dhx36 UTSW 3 62,404,241 (GRCm39) missense probably damaging 0.98
R6392:Dhx36 UTSW 3 62,401,790 (GRCm39) missense probably benign 0.00
R6433:Dhx36 UTSW 3 62,392,395 (GRCm39) missense probably damaging 1.00
R6504:Dhx36 UTSW 3 62,396,060 (GRCm39) missense probably benign
R6615:Dhx36 UTSW 3 62,396,338 (GRCm39) missense probably benign
R6672:Dhx36 UTSW 3 62,408,300 (GRCm39) missense probably benign 0.00
R7172:Dhx36 UTSW 3 62,408,436 (GRCm39) missense probably benign
R7302:Dhx36 UTSW 3 62,386,814 (GRCm39) missense probably benign
R7487:Dhx36 UTSW 3 62,391,623 (GRCm39) missense possibly damaging 0.91
R7515:Dhx36 UTSW 3 62,379,508 (GRCm39) missense probably benign 0.45
R7531:Dhx36 UTSW 3 62,392,389 (GRCm39) missense probably damaging 1.00
R7579:Dhx36 UTSW 3 62,388,294 (GRCm39) missense possibly damaging 0.64
R7726:Dhx36 UTSW 3 62,396,389 (GRCm39) missense probably benign 0.01
R7874:Dhx36 UTSW 3 62,396,052 (GRCm39) missense probably benign
R8056:Dhx36 UTSW 3 62,396,012 (GRCm39) missense possibly damaging 0.93
R8226:Dhx36 UTSW 3 62,377,991 (GRCm39) missense probably benign 0.01
R8361:Dhx36 UTSW 3 62,388,221 (GRCm39) critical splice donor site probably null
R8529:Dhx36 UTSW 3 62,414,277 (GRCm39) small deletion probably benign
R8737:Dhx36 UTSW 3 62,386,747 (GRCm39) missense probably benign
R8947:Dhx36 UTSW 3 62,380,387 (GRCm39) missense probably benign
R9098:Dhx36 UTSW 3 62,414,142 (GRCm39) missense probably benign 0.00
R9098:Dhx36 UTSW 3 62,414,141 (GRCm39) nonsense probably null
R9209:Dhx36 UTSW 3 62,378,895 (GRCm39) missense probably benign 0.21
R9718:Dhx36 UTSW 3 62,379,466 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAAGGGTATGCTGAGATGCC -3'
(R):5'- AGTGTGTCATGCTCAGAGC -3'

Sequencing Primer
(F):5'- AGAGAACTGACTCCTGCAGTTTGTC -3'
(R):5'- CACCGCTCAGCTTCAGGTAC -3'
Posted On 2018-07-23