Mutagenetix > Incidental Mutation

Incidental Mutation 'R6673:Shc1'

527189

Institutional Source

Beutler Lab

Gene Symbol

Shc1

Ensembl Gene

ENSMUSG00000042626

Gene Name

src homology 2 domain-containing transforming protein C1

Synonyms

ShcA, p66shc, p66

MMRRC Submission

044793-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R6673 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89325858-89337336 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89329269 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 38 (S38P)

Ref Sequence

ENSEMBL: ENSMUSP00000091940 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029679] [ENSMUST00000039110] [ENSMUST00000094378] [ENSMUST00000107417] [ENSMUST00000107422] [ENSMUST00000125036] [ENSMUST00000128238] [ENSMUST00000137793] [ENSMUST00000154791] [ENSMUST00000191485] [ENSMUST00000183484]

AlphaFold

P98083

Predicted Effect

probably benign
Transcript: ENSMUST00000029679

SMART Domains

Protein: ENSMUSP00000029679
Gene: ENSMUSG00000028044

Domain	Start	End	E-Value	Type
CKS	5	74	4.1e-48	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000039110

SMART Domains

Protein: ENSMUSP00000035361
Gene: ENSMUSG00000042626

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
PTB	47	211	2.15e-31	SMART
SH2	372	451	1.71e-26	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094378
AA Change: S38P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000091940
Gene: ENSMUSG00000042626
AA Change: S38P

Domain	Start	End	E-Value	Type
low complexity region	16	55	N/A	INTRINSIC
low complexity region	85	98	N/A	INTRINSIC
low complexity region	116	127	N/A	INTRINSIC
PTB	157	321	2.15e-31	SMART
SH2	482	561	1.71e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107417

SMART Domains

Protein: ENSMUSP00000103040
Gene: ENSMUSG00000042626

Domain	Start	End	E-Value	Type
PTB	2	166	2.15e-31	SMART
SH2	327	406	1.71e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107422

SMART Domains

Protein: ENSMUSP00000103045
Gene: ENSMUSG00000028044

Domain	Start	End	E-Value	Type
CKS	1	52	3.88e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125036

SMART Domains

Protein: ENSMUSP00000115509
Gene: ENSMUSG00000042626

Domain	Start	End	E-Value	Type
PTB	1	155	1.5e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128238

SMART Domains

Protein: ENSMUSP00000119293
Gene: ENSMUSG00000042626

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
Pfam:PID	52	144	7.7e-19	PFAM
Pfam:PID	134	190	7.8e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137793

SMART Domains

Protein: ENSMUSP00000117190
Gene: ENSMUSG00000042626

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
PTB	47	211	2.15e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000154791

SMART Domains

Protein: ENSMUSP00000123635
Gene: ENSMUSG00000042626

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
Pfam:PID	52	100	5.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000191485

SMART Domains

Protein: ENSMUSP00000140336
Gene: ENSMUSG00000042626

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
PTB	47	211	2.15e-31	SMART
SH2	372	451	1.71e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183484

SMART Domains

Protein: ENSMUSP00000138900
Gene: ENSMUSG00000028044

Domain	Start	End	E-Value	Type
Pfam:CKS	5	36	2.4e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153334

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146306

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes with a targeted mutation of the exon encoding the CH2 region show an extended life span, reduced cellular sensitivity to oxidative stress and UV irradiation, and resistance to diet-induced atherogenesis. Homozygotes lacking all three isoformsdie around E11.5 with cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Armh4	T	A	14: 50,008,049 (GRCm39)	M475L	probably benign	Het
Cenpb	A	T	2: 131,021,165 (GRCm39)	L211H	probably damaging	Het
Ckmt1	C	T	2: 121,190,151 (GRCm39)	P82S	probably damaging	Het
Cspg4b	C	T	13: 113,504,366 (GRCm39)	Q1832*	probably null	Het
Fbxo38	A	G	18: 62,666,986 (GRCm39)	C138R	probably damaging	Het
Hkdc1	A	G	10: 62,239,385 (GRCm39)	V306A	probably damaging	Het
Mecom	T	C	3: 30,034,851 (GRCm39)	N275S	probably benign	Het
Mpdz	T	C	4: 81,274,667 (GRCm39)	D185G	probably benign	Het
Prtg	T	A	9: 72,758,964 (GRCm39)	N439K	probably damaging	Het
Rsf1	GGCGGCGG	GGCGGCGGGGGCGGCGG	7: 97,229,125 (GRCm39)		probably benign	Het
Serpina3b	A	G	12: 104,096,928 (GRCm39)	N70D	probably damaging	Het
Slc13a2	T	A	11: 78,288,657 (GRCm39)	I540F	probably benign	Het
Tmem33	T	C	5: 67,443,468 (GRCm39)	V215A	probably benign	Het
Trappc8	A	G	18: 21,018,314 (GRCm39)	V53A	probably benign	Het
Trim41	TTCCTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCCTCC	11: 48,707,084 (GRCm39)		probably benign	Het

Other mutations in Shc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Shc1	APN	3	89,331,536 (GRCm39)	missense	probably damaging	0.99
IGL01608:Shc1	APN	3	89,332,156 (GRCm39)	missense	probably damaging	0.96
IGL02710:Shc1	APN	3	89,331,917 (GRCm39)	splice site	probably null
PIT4382001:Shc1	UTSW	3	89,334,715 (GRCm39)	missense	probably benign	0.00
R0323:Shc1	UTSW	3	89,331,020 (GRCm39)	missense	probably damaging	0.98
R0445:Shc1	UTSW	3	89,333,844 (GRCm39)	missense	probably damaging	1.00
R0827:Shc1	UTSW	3	89,334,090 (GRCm39)	splice site	probably null
R0833:Shc1	UTSW	3	89,330,276 (GRCm39)	missense	probably damaging	1.00
R0836:Shc1	UTSW	3	89,330,276 (GRCm39)	missense	probably damaging	1.00
R1155:Shc1	UTSW	3	89,332,126 (GRCm39)	missense	probably benign	0.30
R1497:Shc1	UTSW	3	89,335,752 (GRCm39)	makesense	probably null
R1929:Shc1	UTSW	3	89,330,849 (GRCm39)	missense	probably damaging	1.00
R2271:Shc1	UTSW	3	89,330,849 (GRCm39)	missense	probably damaging	1.00
R4402:Shc1	UTSW	3	89,333,985 (GRCm39)	missense	probably benign
R4965:Shc1	UTSW	3	89,334,303 (GRCm39)	missense	probably damaging	0.98
R5898:Shc1	UTSW	3	89,334,274 (GRCm39)	nonsense	probably null
R6198:Shc1	UTSW	3	89,329,414 (GRCm39)	missense	probably benign
R6604:Shc1	UTSW	3	89,329,186 (GRCm39)	missense	probably damaging	1.00
R6705:Shc1	UTSW	3	89,330,266 (GRCm39)	nonsense	probably null
R7379:Shc1	UTSW	3	89,334,129 (GRCm39)	missense	probably benign	0.00
R8041:Shc1	UTSW	3	89,330,260 (GRCm39)	missense	probably damaging	1.00
R8284:Shc1	UTSW	3	89,329,215 (GRCm39)	missense	possibly damaging	0.70
R8700:Shc1	UTSW	3	89,334,740 (GRCm39)	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CATCTGTTATCACCGGGCTG -3'
(R):5'- CAGCTTGTTCATGTCCTGGAGG -3'

Sequencing Primer
(F):5'- TGCCGAGGTCAGACTAGG -3'
(R):5'- CAAGAGGCCTGAGTCCCGAAG -3'

Posted On

2018-07-23