Incidental Mutation 'R6673:3632451O06Rik'
ID527199
Institutional Source Beutler Lab
Gene Symbol 3632451O06Rik
Ensembl Gene ENSMUSG00000036242
Gene NameRIKEN cDNA 3632451O06 gene
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_026142.4; MGI:1914669

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6673 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location49675952-49783383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49770592 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 475 (M475L)
Ref Sequence ENSEMBL: ENSMUSP00000113609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036972] [ENSMUST00000118129]
Predicted Effect probably benign
Transcript: ENSMUST00000036972
AA Change: M475L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036220
Gene: ENSMUSG00000036242
AA Change: M475L

DomainStartEndE-ValueType
Pfam:DUF4696 48 609 3.8e-224 PFAM
transmembrane domain 714 736 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118129
AA Change: M475L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113609
Gene: ENSMUSG00000036242
AA Change: M475L

DomainStartEndE-ValueType
coiled coil region 603 644 N/A INTRINSIC
transmembrane domain 714 736 N/A INTRINSIC
low complexity region 741 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC067074 C T 13: 113,367,832 Q1832* probably null Het
Cenpb A T 2: 131,179,245 L211H probably damaging Het
Ckmt1 C T 2: 121,359,670 P82S probably damaging Het
Fbxo38 A G 18: 62,533,915 C138R probably damaging Het
Hkdc1 A G 10: 62,403,606 V306A probably damaging Het
Mecom T C 3: 29,980,702 N275S probably benign Het
Mpdz T C 4: 81,356,430 D185G probably benign Het
Prtg T A 9: 72,851,682 N439K probably damaging Het
Rsf1 GGCGGCGG GGCGGCGGGGGCGGCGG 7: 97,579,918 probably benign Het
Serpina3b A G 12: 104,130,669 N70D probably damaging Het
Shc1 T C 3: 89,421,962 S38P possibly damaging Het
Slc13a2 T A 11: 78,397,831 I540F probably benign Het
Tmem33 T C 5: 67,286,125 V215A probably benign Het
Trappc8 A G 18: 20,885,257 V53A probably benign Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Other mutations in 3632451O06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:3632451O06Rik APN 14 49773003 missense probably damaging 1.00
IGL00981:3632451O06Rik APN 14 49772990 missense probably damaging 1.00
IGL01447:3632451O06Rik APN 14 49768466 missense probably damaging 0.99
IGL01645:3632451O06Rik APN 14 49773554 missense probably damaging 1.00
IGL02135:3632451O06Rik APN 14 49773929 missense probably damaging 0.99
IGL02154:3632451O06Rik APN 14 49772942 missense possibly damaging 0.58
IGL02163:3632451O06Rik APN 14 49774157 missense possibly damaging 0.61
IGL03234:3632451O06Rik APN 14 49768516 missense probably damaging 1.00
P0014:3632451O06Rik UTSW 14 49751659 missense probably damaging 1.00
R0165:3632451O06Rik UTSW 14 49773786 missense probably benign
R0240:3632451O06Rik UTSW 14 49768402 splice site probably benign
R0553:3632451O06Rik UTSW 14 49682686 missense probably damaging 0.99
R0616:3632451O06Rik UTSW 14 49773656 missense possibly damaging 0.74
R0635:3632451O06Rik UTSW 14 49773143 missense probably benign 0.00
R1423:3632451O06Rik UTSW 14 49751439 missense probably damaging 1.00
R1547:3632451O06Rik UTSW 14 49773496 missense probably benign 0.01
R1642:3632451O06Rik UTSW 14 49768410 splice site probably null
R1657:3632451O06Rik UTSW 14 49773560 missense probably damaging 0.99
R1717:3632451O06Rik UTSW 14 49751664 missense probably damaging 0.99
R1875:3632451O06Rik UTSW 14 49682358 missense probably damaging 1.00
R1900:3632451O06Rik UTSW 14 49770583 missense probably damaging 1.00
R1916:3632451O06Rik UTSW 14 49768475 missense probably damaging 1.00
R1945:3632451O06Rik UTSW 14 49768483 missense probably damaging 1.00
R2102:3632451O06Rik UTSW 14 49774002 missense probably damaging 0.98
R2147:3632451O06Rik UTSW 14 49751571 missense probably benign 0.31
R2149:3632451O06Rik UTSW 14 49751571 missense probably benign 0.31
R3921:3632451O06Rik UTSW 14 49774202 missense probably benign 0.13
R4063:3632451O06Rik UTSW 14 49773987 missense probably benign 0.02
R4373:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4374:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4377:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4589:3632451O06Rik UTSW 14 49773582 missense probably damaging 1.00
R4940:3632451O06Rik UTSW 14 49773482 missense probably benign 0.15
R4986:3632451O06Rik UTSW 14 49751654 missense probably damaging 0.97
R5047:3632451O06Rik UTSW 14 49770438 missense probably damaging 1.00
R5104:3632451O06Rik UTSW 14 49773472 missense possibly damaging 0.77
R5682:3632451O06Rik UTSW 14 49751586 missense probably damaging 1.00
R6357:3632451O06Rik UTSW 14 49773312 missense probably benign 0.10
R6478:3632451O06Rik UTSW 14 49773332 missense possibly damaging 0.61
R7035:3632451O06Rik UTSW 14 49773050 missense possibly damaging 0.77
R7054:3632451O06Rik UTSW 14 49773698 missense probably damaging 1.00
X0026:3632451O06Rik UTSW 14 49682736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCATGGAAGAGGTAAGTTTGAG -3'
(R):5'- CTCCCTTGAGCAGCAAAAGC -3'

Sequencing Primer
(F):5'- TTTGAGAGACAAAGGGACAACAGTG -3'
(R):5'- AGCAACACTGTTTACTGGTCCATG -3'
Posted On2018-07-23