Incidental Mutation 'R6674:Vmn2r117'
ID527225
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Namevomeronasal 2, receptor 117
SynonymsEG619788
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R6674 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location23459675-23479597 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 23460049 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 734 (Q734*)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
Predicted Effect probably null
Transcript: ENSMUST00000171996
AA Change: Q734*
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: Q734*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,974,998 E92G probably benign Het
Cluh A G 11: 74,666,227 H1005R probably damaging Het
Coro2b C T 9: 62,432,427 R13H probably damaging Het
Depdc1a T A 3: 159,526,707 N698K probably benign Het
Dusp12 G A 1: 170,879,748 T257I probably benign Het
Esf1 T A 2: 140,120,806 K782* probably null Het
Extl1 T C 4: 134,358,127 T560A probably damaging Het
Gpr179 C A 11: 97,347,405 probably null Het
Krt90 G A 15: 101,557,326 L287F probably damaging Het
Mertk T C 2: 128,729,357 V77A probably benign Het
Nr4a2 C T 2: 57,112,424 A6T probably damaging Het
Pdzd8 G A 19: 59,301,369 P533L probably damaging Het
Plxnb1 G A 9: 109,108,146 G1132R probably benign Het
Ppfia2 A G 10: 106,927,772 I1209V probably benign Het
Slc26a9 A T 1: 131,765,018 Q696L probably benign Het
Sphkap A T 1: 83,277,834 S444R probably benign Het
Tmem144 A G 3: 79,839,183 F22L possibly damaging Het
Tomm20l A G 12: 71,111,533 D30G probably damaging Het
Trpc2 A G 7: 102,096,057 T827A probably benign Het
Unc50 T C 1: 37,437,458 V208A probably benign Het
Vmn1r125 T C 7: 21,272,713 S179P probably damaging Het
Vmn1r225 A C 17: 20,503,115 I273L probably benign Het
Vmn2r88 A G 14: 51,414,338 I378V probably benign Het
Zfp507 C T 7: 35,794,734 V295I probably damaging Het
Zfp981 A G 4: 146,535,493 R35G probably damaging Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23477840 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23475429 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23479546 missense probably benign
IGL01078:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23478382 missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23477241 missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23475382 missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23477225 missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23459784 missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23475578 splice site probably benign
IGL03167:Vmn2r117 APN 17 23477707 missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23460165 missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23475514 missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23475503 nonsense probably null
R1411:Vmn2r117 UTSW 17 23460553 missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23478473 missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23477455 missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23478389 missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23477480 missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23477644 missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23460256 missense possibly damaging 0.55
R2698:Vmn2r117 UTSW 17 23459911 missense probably damaging 0.98
R2972:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2973:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R3160:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3847:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R3848:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23460106 missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23479513 frame shift probably null
R4560:Vmn2r117 UTSW 17 23459877 missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23478416 missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23477885 missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23459838 missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23479513 frame shift probably null
R5078:Vmn2r117 UTSW 17 23460148 missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23477874 nonsense probably null
R5774:Vmn2r117 UTSW 17 23477202 missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23479561 missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23460114 missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23460219 missense probably damaging 0.99
R6736:Vmn2r117 UTSW 17 23478308 missense probably damaging 0.99
R6909:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23479563 missense probably damaging 0.99
R7220:Vmn2r117 UTSW 17 23477203 missense probably damaging 1.00
R7260:Vmn2r117 UTSW 17 23475385 missense probably benign 0.06
V5622:Vmn2r117 UTSW 17 23477840 missense probably damaging 1.00
V5622:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CATGACCTTGCCTTTGGTGC -3'
(R):5'- TCCACTGTCTTGGCTAAAACG -3'

Sequencing Primer
(F):5'- GCCTTTGGTGCTATAGTAAACAG -3'
(R):5'- CCACTGTCTTGGCTAAAACGATTAC -3'
Posted On2018-07-23