Incidental Mutation 'R6675:Hsd3b2'
ID527238
Institutional Source Beutler Lab
Gene Symbol Hsd3b2
Ensembl Gene ENSMUSG00000063730
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R6675 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location98709255-98724543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98713472 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 89 (T89I)
Ref Sequence ENSEMBL: ENSMUSP00000136533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107021] [ENSMUST00000107022] [ENSMUST00000177651]
Predicted Effect probably benign
Transcript: ENSMUST00000107021
AA Change: T89I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102635
Gene: ENSMUSG00000063730
AA Change: T89I

DomainStartEndE-ValueType
Pfam:KR 5 130 3.9e-7 PFAM
Pfam:adh_short 5 133 5.6e-8 PFAM
Pfam:Polysacc_synt_2 6 135 2.1e-13 PFAM
Pfam:NmrA 6 139 7.7e-8 PFAM
Pfam:NAD_binding_10 6 207 1.4e-9 PFAM
Pfam:Epimerase 6 254 2.5e-26 PFAM
Pfam:3Beta_HSD 7 288 1.2e-112 PFAM
Pfam:NAD_binding_4 8 221 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107022
AA Change: T89I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102636
Gene: ENSMUSG00000063730
AA Change: T89I

DomainStartEndE-ValueType
Pfam:KR 5 130 3.9e-7 PFAM
Pfam:adh_short 5 133 5.6e-8 PFAM
Pfam:Polysacc_synt_2 6 135 2.1e-13 PFAM
Pfam:NmrA 6 139 7.7e-8 PFAM
Pfam:NAD_binding_10 6 207 1.4e-9 PFAM
Pfam:Epimerase 6 254 2.5e-26 PFAM
Pfam:3Beta_HSD 7 288 1.2e-112 PFAM
Pfam:NAD_binding_4 8 221 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177651
AA Change: T89I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000136533
Gene: ENSMUSG00000063730
AA Change: T89I

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 6 136 1.2e-13 PFAM
Pfam:NmrA 6 140 1.7e-7 PFAM
Pfam:Epimerase 6 249 2.1e-25 PFAM
Pfam:GDP_Man_Dehyd 7 187 2.7e-13 PFAM
Pfam:3Beta_HSD 7 288 8.2e-114 PFAM
Pfam:NAD_binding_4 8 223 1.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,115,476 T1268A probably benign Het
Adamts20 A G 15: 94,331,316 probably null Het
Arhgap45 G T 10: 80,018,104 D151Y probably null Het
Arhgef40 C A 14: 51,991,641 L592I probably damaging Het
Ascc3 G T 10: 50,750,563 E1720* probably null Het
Atp2c1 C T 9: 105,453,533 probably null Het
Avpi1 G A 19: 42,123,744 P125L probably benign Het
Cers3 A T 7: 66,786,096 T232S possibly damaging Het
Cfap53 T C 18: 74,307,376 probably null Het
Col4a3 T C 1: 82,668,925 S386P unknown Het
Dhtkd1 A T 2: 5,904,078 M735K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Gad2 T C 2: 22,673,985 V400A possibly damaging Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm13103 G A 4: 143,853,258 C471Y probably damaging Het
Hmgxb3 T G 18: 61,137,576 D892A possibly damaging Het
Iars C A 13: 49,719,578 A713D probably damaging Het
Itih1 G A 14: 30,929,841 T848I possibly damaging Het
Kcne2 A G 16: 92,296,624 D13G probably benign Het
Klra17 T A 6: 129,872,323 N96I probably damaging Het
Lrig2 T C 3: 104,457,935 N634D probably benign Het
Mrc2 T A 11: 105,343,080 probably null Het
Mroh3 A T 1: 136,190,812 S558T possibly damaging Het
Ncapg2 G T 12: 116,434,661 K627N possibly damaging Het
Ncstn A T 1: 172,071,528 D345E probably damaging Het
Nkx1-1 G T 5: 33,433,879 A33E unknown Het
Olfr134 T A 17: 38,176,014 M310K probably benign Het
Olfr568 A G 7: 102,877,273 E51G possibly damaging Het
Osbpl9 G T 4: 109,133,828 probably null Het
P2rx6 T C 16: 17,562,168 V52A probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Pdk2 T C 11: 95,028,742 I273V probably benign Het
Pdpr C T 8: 111,101,900 Q12* probably null Het
Plxdc2 A G 2: 16,712,121 T339A probably benign Het
Retsat T C 6: 72,601,689 V128A probably benign Het
Rnf17 A G 14: 56,459,975 E442G probably damaging Het
Sec31b T C 19: 44,523,775 N560S probably benign Het
Slc22a16 C T 10: 40,573,840 Q91* probably null Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Slc26a4 A T 12: 31,540,513 D380E possibly damaging Het
Stc2 T A 11: 31,360,307 D243V probably benign Het
Tshz2 G T 2: 169,886,045 A385S probably damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vmn1r77 A G 7: 12,041,455 T53A probably damaging Het
Zeb2 A T 2: 44,997,445 Y518* probably null Het
Zfp760 T A 17: 21,723,010 S389T possibly damaging Het
Other mutations in Hsd3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Hsd3b2 APN 3 98711543 missense possibly damaging 0.47
IGL01102:Hsd3b2 APN 3 98711679 missense probably damaging 0.97
IGL01733:Hsd3b2 APN 3 98716485 missense probably damaging 1.00
IGL02202:Hsd3b2 APN 3 98711867 missense possibly damaging 0.85
IGL02851:Hsd3b2 APN 3 98716424 missense possibly damaging 0.84
R1737:Hsd3b2 UTSW 3 98711546 missense probably damaging 1.00
R1800:Hsd3b2 UTSW 3 98712237 missense probably damaging 1.00
R1917:Hsd3b2 UTSW 3 98712026 missense probably benign
R4797:Hsd3b2 UTSW 3 98711663 missense probably damaging 1.00
R5354:Hsd3b2 UTSW 3 98712315 missense probably benign 0.39
R5412:Hsd3b2 UTSW 3 98711892 missense possibly damaging 0.88
R5940:Hsd3b2 UTSW 3 98711971 missense probably benign 0.02
R5954:Hsd3b2 UTSW 3 98711559 missense probably benign 0.06
R6012:Hsd3b2 UTSW 3 98712017 missense probably benign
R6083:Hsd3b2 UTSW 3 98712056 missense possibly damaging 0.94
X0054:Hsd3b2 UTSW 3 98713500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATCTAGTGAGCAGAGGC -3'
(R):5'- TGAATGAGTCAACTTCCCACC -3'

Sequencing Primer
(F):5'- TCTAGTGAGCAGAGGCATTAGAC -3'
(R):5'- TGAATGAGTCAACTTCCCACCTACTC -3'
Posted On2018-07-23