Incidental Mutation 'R6675:Klra17'
ID527244
Institutional Source Beutler Lab
Gene Symbol Klra17
Ensembl Gene ENSMUSG00000014543
Gene Namekiller cell lectin-like receptor, subfamily A, member 17
SynonymsLy49q1, Ly-49Q, Ly49Q
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.030) question?
Stock #R6675 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location129831154-129876672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129872323 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 96 (N96I)
Ref Sequence ENSEMBL: ENSMUSP00000114108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014687] [ENSMUST00000122219]
Predicted Effect probably damaging
Transcript: ENSMUST00000014687
AA Change: N96I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000014687
Gene: ENSMUSG00000014543
AA Change: N96I

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
Blast:CLECT 73 126 2e-12 BLAST
CLECT 144 259 1.5e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122219
AA Change: N96I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114108
Gene: ENSMUSG00000014543
AA Change: N96I

DomainStartEndE-ValueType
low complexity region 53 70 N/A INTRINSIC
Blast:CLECT 74 127 2e-12 BLAST
CLECT 145 260 1.5e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit reduced plasmacytoid dendritic cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,115,476 T1268A probably benign Het
Adamts20 A G 15: 94,331,316 probably null Het
Arhgap45 G T 10: 80,018,104 D151Y probably null Het
Arhgef40 C A 14: 51,991,641 L592I probably damaging Het
Ascc3 G T 10: 50,750,563 E1720* probably null Het
Atp2c1 C T 9: 105,453,533 probably null Het
Avpi1 G A 19: 42,123,744 P125L probably benign Het
Cers3 A T 7: 66,786,096 T232S possibly damaging Het
Cfap53 T C 18: 74,307,376 probably null Het
Col4a3 T C 1: 82,668,925 S386P unknown Het
Dhtkd1 A T 2: 5,904,078 M735K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Gad2 T C 2: 22,673,985 V400A possibly damaging Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm13103 G A 4: 143,853,258 C471Y probably damaging Het
Hmgxb3 T G 18: 61,137,576 D892A possibly damaging Het
Hsd3b2 G A 3: 98,713,472 T89I probably benign Het
Iars C A 13: 49,719,578 A713D probably damaging Het
Itih1 G A 14: 30,929,841 T848I possibly damaging Het
Kcne2 A G 16: 92,296,624 D13G probably benign Het
Lrig2 T C 3: 104,457,935 N634D probably benign Het
Mrc2 T A 11: 105,343,080 probably null Het
Mroh3 A T 1: 136,190,812 S558T possibly damaging Het
Ncapg2 G T 12: 116,434,661 K627N possibly damaging Het
Ncstn A T 1: 172,071,528 D345E probably damaging Het
Nkx1-1 G T 5: 33,433,879 A33E unknown Het
Olfr134 T A 17: 38,176,014 M310K probably benign Het
Olfr568 A G 7: 102,877,273 E51G possibly damaging Het
Osbpl9 G T 4: 109,133,828 probably null Het
P2rx6 T C 16: 17,562,168 V52A probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Pdk2 T C 11: 95,028,742 I273V probably benign Het
Pdpr C T 8: 111,101,900 Q12* probably null Het
Plxdc2 A G 2: 16,712,121 T339A probably benign Het
Retsat T C 6: 72,601,689 V128A probably benign Het
Rnf17 A G 14: 56,459,975 E442G probably damaging Het
Sec31b T C 19: 44,523,775 N560S probably benign Het
Slc22a16 C T 10: 40,573,840 Q91* probably null Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Slc26a4 A T 12: 31,540,513 D380E possibly damaging Het
Stc2 T A 11: 31,360,307 D243V probably benign Het
Tshz2 G T 2: 169,886,045 A385S probably damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vmn1r77 A G 7: 12,041,455 T53A probably damaging Het
Zeb2 A T 2: 44,997,445 Y518* probably null Het
Zfp760 T A 17: 21,723,010 S389T possibly damaging Het
Other mutations in Klra17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Klra17 APN 6 129831509 missense probably benign 0.12
IGL02084:Klra17 APN 6 129831593 missense probably damaging 1.00
IGL02995:Klra17 APN 6 129868684 critical splice donor site probably null
IGL03238:Klra17 APN 6 129868810 missense probably benign 0.43
R0118:Klra17 UTSW 6 129831589 missense probably benign 0.01
R0583:Klra17 UTSW 6 129868693 missense probably damaging 1.00
R1103:Klra17 UTSW 6 129868843 unclassified probably benign
R1378:Klra17 UTSW 6 129865684 missense probably damaging 0.96
R1513:Klra17 UTSW 6 129872314 missense possibly damaging 0.61
R1817:Klra17 UTSW 6 129868718 unclassified probably null
R2262:Klra17 UTSW 6 129874794 critical splice donor site probably null
R2446:Klra17 UTSW 6 129831514 missense probably benign 0.02
R2484:Klra17 UTSW 6 129868757 missense probably damaging 1.00
R3410:Klra17 UTSW 6 129874846 missense probably damaging 0.99
R3411:Klra17 UTSW 6 129874846 missense probably damaging 0.99
R3739:Klra17 UTSW 6 129873365 missense probably benign 0.03
R4747:Klra17 UTSW 6 129872269 missense probably damaging 0.97
R4956:Klra17 UTSW 6 129873316 missense probably damaging 1.00
R5079:Klra17 UTSW 6 129872196 missense possibly damaging 0.72
R5310:Klra17 UTSW 6 129868708 missense probably damaging 1.00
R5366:Klra17 UTSW 6 129874895 missense possibly damaging 0.89
R5875:Klra17 UTSW 6 129874828 missense probably benign 0.01
R6043:Klra17 UTSW 6 129872187 critical splice donor site probably null
R6515:Klra17 UTSW 6 129831499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGACTTCAAAGCTTCTGG -3'
(R):5'- ACTTCCAGGCTGTGCTAAAAC -3'

Sequencing Primer
(F):5'- GACTTCAAAGCTTCTGGAGAATAAAG -3'
(R):5'- ACTTCCAACATAATTTTGTTCAGTTG -3'
Posted On2018-07-23