Incidental Mutation 'R6675:Mrc2'
ID527256
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6675 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 105343080 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect probably null
Transcript: ENSMUST00000021038
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100335
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151135
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,115,476 T1268A probably benign Het
Adamts20 A G 15: 94,331,316 probably null Het
Arhgap45 G T 10: 80,018,104 D151Y probably null Het
Arhgef40 C A 14: 51,991,641 L592I probably damaging Het
Ascc3 G T 10: 50,750,563 E1720* probably null Het
Atp2c1 C T 9: 105,453,533 probably null Het
Avpi1 G A 19: 42,123,744 P125L probably benign Het
Cers3 A T 7: 66,786,096 T232S possibly damaging Het
Cfap53 T C 18: 74,307,376 probably null Het
Col4a3 T C 1: 82,668,925 S386P unknown Het
Dhtkd1 A T 2: 5,904,078 M735K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Gad2 T C 2: 22,673,985 V400A possibly damaging Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm13103 G A 4: 143,853,258 C471Y probably damaging Het
Hmgxb3 T G 18: 61,137,576 D892A possibly damaging Het
Hsd3b2 G A 3: 98,713,472 T89I probably benign Het
Iars C A 13: 49,719,578 A713D probably damaging Het
Itih1 G A 14: 30,929,841 T848I possibly damaging Het
Kcne2 A G 16: 92,296,624 D13G probably benign Het
Klra17 T A 6: 129,872,323 N96I probably damaging Het
Lrig2 T C 3: 104,457,935 N634D probably benign Het
Mroh3 A T 1: 136,190,812 S558T possibly damaging Het
Ncapg2 G T 12: 116,434,661 K627N possibly damaging Het
Ncstn A T 1: 172,071,528 D345E probably damaging Het
Nkx1-1 G T 5: 33,433,879 A33E unknown Het
Olfr134 T A 17: 38,176,014 M310K probably benign Het
Olfr568 A G 7: 102,877,273 E51G possibly damaging Het
Osbpl9 G T 4: 109,133,828 probably null Het
P2rx6 T C 16: 17,562,168 V52A probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Pdk2 T C 11: 95,028,742 I273V probably benign Het
Pdpr C T 8: 111,101,900 Q12* probably null Het
Plxdc2 A G 2: 16,712,121 T339A probably benign Het
Retsat T C 6: 72,601,689 V128A probably benign Het
Rnf17 A G 14: 56,459,975 E442G probably damaging Het
Sec31b T C 19: 44,523,775 N560S probably benign Het
Slc22a16 C T 10: 40,573,840 Q91* probably null Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Slc26a4 A T 12: 31,540,513 D380E possibly damaging Het
Stc2 T A 11: 31,360,307 D243V probably benign Het
Tshz2 G T 2: 169,886,045 A385S probably damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vmn1r77 A G 7: 12,041,455 T53A probably damaging Het
Zeb2 A T 2: 44,997,445 Y518* probably null Het
Zfp760 T A 17: 21,723,010 S389T possibly damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCGCACTTCTTTGCTGTAAGG -3'
(R):5'- GGACCATCCATTGATCCTTGG -3'

Sequencing Primer
(F):5'- CACTTCTTTGCTGTAAGGGTTTTCAG -3'
(R):5'- CCAATGGGTCTAGGTTTTC -3'
Posted On2018-07-23