Incidental Mutation 'R6675:Abca9'
ID527257
Institutional Source Beutler Lab
Gene Symbol Abca9
Ensembl Gene ENSMUSG00000041797
Gene NameATP-binding cassette, sub-family A (ABC1), member 9
SynonymsD630040K07Rik
Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6675 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location110100749-110168196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110115476 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1268 (T1268A)
Ref Sequence ENSEMBL: ENSMUSP00000036338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044850]
Predicted Effect probably benign
Transcript: ENSMUST00000044850
AA Change: T1268A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: T1268A

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 419 2.7e-31 PFAM
AAA 509 693 9.28e-12 SMART
low complexity region 817 837 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Pfam:ABC2_membrane_3 918 1219 5.2e-15 PFAM
low complexity region 1250 1259 N/A INTRINSIC
AAA 1317 1497 8.47e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted(1

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A G 15: 94,331,316 probably null Het
Arhgap45 G T 10: 80,018,104 D151Y probably null Het
Arhgef40 C A 14: 51,991,641 L592I probably damaging Het
Ascc3 G T 10: 50,750,563 E1720* probably null Het
Atp2c1 C T 9: 105,453,533 probably null Het
Avpi1 G A 19: 42,123,744 P125L probably benign Het
Cers3 A T 7: 66,786,096 T232S possibly damaging Het
Cfap53 T C 18: 74,307,376 probably null Het
Col4a3 T C 1: 82,668,925 S386P unknown Het
Dhtkd1 A T 2: 5,904,078 M735K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Gad2 T C 2: 22,673,985 V400A possibly damaging Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm13103 G A 4: 143,853,258 C471Y probably damaging Het
Hmgxb3 T G 18: 61,137,576 D892A possibly damaging Het
Hsd3b2 G A 3: 98,713,472 T89I probably benign Het
Iars C A 13: 49,719,578 A713D probably damaging Het
Itih1 G A 14: 30,929,841 T848I possibly damaging Het
Kcne2 A G 16: 92,296,624 D13G probably benign Het
Klra17 T A 6: 129,872,323 N96I probably damaging Het
Lrig2 T C 3: 104,457,935 N634D probably benign Het
Mrc2 T A 11: 105,343,080 probably null Het
Mroh3 A T 1: 136,190,812 S558T possibly damaging Het
Ncapg2 G T 12: 116,434,661 K627N possibly damaging Het
Ncstn A T 1: 172,071,528 D345E probably damaging Het
Nkx1-1 G T 5: 33,433,879 A33E unknown Het
Olfr134 T A 17: 38,176,014 M310K probably benign Het
Olfr568 A G 7: 102,877,273 E51G possibly damaging Het
Osbpl9 G T 4: 109,133,828 probably null Het
P2rx6 T C 16: 17,562,168 V52A probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Pdk2 T C 11: 95,028,742 I273V probably benign Het
Pdpr C T 8: 111,101,900 Q12* probably null Het
Plxdc2 A G 2: 16,712,121 T339A probably benign Het
Retsat T C 6: 72,601,689 V128A probably benign Het
Rnf17 A G 14: 56,459,975 E442G probably damaging Het
Sec31b T C 19: 44,523,775 N560S probably benign Het
Slc22a16 C T 10: 40,573,840 Q91* probably null Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Slc26a4 A T 12: 31,540,513 D380E possibly damaging Het
Stc2 T A 11: 31,360,307 D243V probably benign Het
Tshz2 G T 2: 169,886,045 A385S probably damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vmn1r77 A G 7: 12,041,455 T53A probably damaging Het
Zeb2 A T 2: 44,997,445 Y518* probably null Het
Zfp760 T A 17: 21,723,010 S389T possibly damaging Het
Other mutations in Abca9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Abca9 APN 11 110160516 missense probably benign
IGL00467:Abca9 APN 11 110145670 splice site probably benign
IGL00886:Abca9 APN 11 110163275 missense possibly damaging 0.93
IGL01340:Abca9 APN 11 110130627 missense probably benign
IGL01351:Abca9 APN 11 110148903 missense probably damaging 0.99
IGL01383:Abca9 APN 11 110113293 splice site probably benign
IGL01384:Abca9 APN 11 110145637 missense probably damaging 1.00
IGL01482:Abca9 APN 11 110120773 missense probably benign 0.05
IGL01586:Abca9 APN 11 110154417 missense probably damaging 0.99
IGL01589:Abca9 APN 11 110155177 missense probably damaging 1.00
IGL01926:Abca9 APN 11 110135329 splice site probably benign
IGL02059:Abca9 APN 11 110160394 splice site probably benign
IGL02084:Abca9 APN 11 110130597 missense probably benign
IGL02096:Abca9 APN 11 110102533 missense probably damaging 1.00
IGL02096:Abca9 APN 11 110165980 missense probably benign 0.01
IGL02290:Abca9 APN 11 110135351 missense probably damaging 1.00
IGL02303:Abca9 APN 11 110154550 missense probably damaging 1.00
IGL02549:Abca9 APN 11 110102053 missense probably damaging 1.00
IGL02687:Abca9 APN 11 110114232 missense probably damaging 1.00
IGL02752:Abca9 APN 11 110127368 missense probably damaging 1.00
IGL02814:Abca9 APN 11 110154467 missense possibly damaging 0.90
IGL02878:Abca9 APN 11 110138329 missense probably benign 0.01
IGL03088:Abca9 APN 11 110144261 missense probably benign 0.06
IGL03231:Abca9 APN 11 110155268 missense probably damaging 0.96
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144871 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144872 missense probably damaging 1.00
R0068:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R0189:Abca9 UTSW 11 110108653 missense probably damaging 1.00
R0189:Abca9 UTSW 11 110141662 splice site probably benign
R0375:Abca9 UTSW 11 110115447 missense probably benign 0.00
R0601:Abca9 UTSW 11 110117058 critical splice donor site probably null
R0624:Abca9 UTSW 11 110139620 missense probably damaging 1.00
R0652:Abca9 UTSW 11 110152063 missense probably benign 0.02
R1004:Abca9 UTSW 11 110151954 missense possibly damaging 0.88
R1222:Abca9 UTSW 11 110145064 splice site probably benign
R1451:Abca9 UTSW 11 110127447 missense probably damaging 1.00
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1474:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R1499:Abca9 UTSW 11 110139632 missense probably benign 0.00
R1778:Abca9 UTSW 11 110130716 nonsense probably null
R2015:Abca9 UTSW 11 110131846 missense probably benign 0.01
R2295:Abca9 UTSW 11 110148903 missense probably damaging 0.99
R2303:Abca9 UTSW 11 110158226 missense probably benign 0.01
R2403:Abca9 UTSW 11 110115454 missense probably benign 0.16
R2886:Abca9 UTSW 11 110144886 splice site probably benign
R3435:Abca9 UTSW 11 110154430 missense probably benign 0.24
R3976:Abca9 UTSW 11 110148789 missense probably benign 0.25
R4335:Abca9 UTSW 11 110152017 missense probably damaging 1.00
R4411:Abca9 UTSW 11 110151955 missense probably benign 0.00
R4613:Abca9 UTSW 11 110144784 missense probably benign 0.26
R4690:Abca9 UTSW 11 110148880 missense probably damaging 1.00
R4720:Abca9 UTSW 11 110127422 missense probably damaging 1.00
R4751:Abca9 UTSW 11 110130570 missense probably benign 0.00
R4797:Abca9 UTSW 11 110118119 missense probably benign
R4818:Abca9 UTSW 11 110155154 critical splice donor site probably null
R4903:Abca9 UTSW 11 110147001 missense probably damaging 1.00
R4971:Abca9 UTSW 11 110152048 missense probably benign 0.43
R4977:Abca9 UTSW 11 110136073 missense probably benign 0.00
R5019:Abca9 UTSW 11 110165934 missense probably benign
R5079:Abca9 UTSW 11 110145569 missense possibly damaging 0.47
R5082:Abca9 UTSW 11 110131868 missense probably benign
R5093:Abca9 UTSW 11 110141532 missense probably damaging 0.98
R5212:Abca9 UTSW 11 110107226 missense probably benign 0.02
R5350:Abca9 UTSW 11 110115538 missense probably benign
R5368:Abca9 UTSW 11 110145546 missense probably damaging 1.00
R5432:Abca9 UTSW 11 110141554 missense possibly damaging 0.83
R5436:Abca9 UTSW 11 110134236 missense probably damaging 1.00
R5497:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R5503:Abca9 UTSW 11 110141610 missense probably damaging 1.00
R5594:Abca9 UTSW 11 110144862 missense probably damaging 1.00
R5742:Abca9 UTSW 11 110160417 missense probably damaging 0.98
R5776:Abca9 UTSW 11 110107460 splice site probably null
R5781:Abca9 UTSW 11 110101987 missense probably damaging 1.00
R5872:Abca9 UTSW 11 110117076 missense possibly damaging 0.70
R5923:Abca9 UTSW 11 110160552 missense probably benign 0.09
R6020:Abca9 UTSW 11 110145613 missense possibly damaging 0.86
R6179:Abca9 UTSW 11 110134254 missense probably benign 0.05
R6245:Abca9 UTSW 11 110135423 missense probably damaging 1.00
R6249:Abca9 UTSW 11 110145627 missense probably benign
R6365:Abca9 UTSW 11 110145655 missense possibly damaging 0.63
R6385:Abca9 UTSW 11 110134254 missense probably damaging 0.99
R6481:Abca9 UTSW 11 110165962 nonsense probably null
R6909:Abca9 UTSW 11 110115497 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATCGTAGCTTGTGGACACTGC -3'
(R):5'- AAGTGAATAGCAGCATCGTTTG -3'

Sequencing Primer
(F):5'- GTAGCTTGTGGACACTGCATACC -3'
(R):5'- TAGCAGCATCGTTTGACCAG -3'
Posted On2018-07-23