Incidental Mutation 'R6675:Olfr134'
ID527269
Institutional Source Beutler Lab
Gene Symbol Olfr134
Ensembl Gene ENSMUSG00000096009
Gene Nameolfactory receptor 134
SynonymsMOR256-5, GA_x6K02T2PSCP-2623613-2624551
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6675 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location38171388-38176578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38176014 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 310 (M310K)
Ref Sequence ENSEMBL: ENSMUSP00000151069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074883] [ENSMUST00000215900]
Predicted Effect probably benign
Transcript: ENSMUST00000074883
AA Change: M310K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074423
Gene: ENSMUSG00000096009
AA Change: M310K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-50 PFAM
Pfam:7tm_1 41 290 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215900
AA Change: M310K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,115,476 T1268A probably benign Het
Adamts20 A G 15: 94,331,316 probably null Het
Arhgap45 G T 10: 80,018,104 D151Y probably null Het
Arhgef40 C A 14: 51,991,641 L592I probably damaging Het
Ascc3 G T 10: 50,750,563 E1720* probably null Het
Atp2c1 C T 9: 105,453,533 probably null Het
Avpi1 G A 19: 42,123,744 P125L probably benign Het
Cers3 A T 7: 66,786,096 T232S possibly damaging Het
Cfap53 T C 18: 74,307,376 probably null Het
Col4a3 T C 1: 82,668,925 S386P unknown Het
Dhtkd1 A T 2: 5,904,078 M735K probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Gad2 T C 2: 22,673,985 V400A possibly damaging Het
Gm10801 TC TCGCC 2: 98,663,806 probably benign Het
Gm13103 G A 4: 143,853,258 C471Y probably damaging Het
Hmgxb3 T G 18: 61,137,576 D892A possibly damaging Het
Hsd3b2 G A 3: 98,713,472 T89I probably benign Het
Iars C A 13: 49,719,578 A713D probably damaging Het
Itih1 G A 14: 30,929,841 T848I possibly damaging Het
Kcne2 A G 16: 92,296,624 D13G probably benign Het
Klra17 T A 6: 129,872,323 N96I probably damaging Het
Lrig2 T C 3: 104,457,935 N634D probably benign Het
Mrc2 T A 11: 105,343,080 probably null Het
Mroh3 A T 1: 136,190,812 S558T possibly damaging Het
Ncapg2 G T 12: 116,434,661 K627N possibly damaging Het
Ncstn A T 1: 172,071,528 D345E probably damaging Het
Nkx1-1 G T 5: 33,433,879 A33E unknown Het
Olfr568 A G 7: 102,877,273 E51G possibly damaging Het
Osbpl9 G T 4: 109,133,828 probably null Het
P2rx6 T C 16: 17,562,168 V52A probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Pdk2 T C 11: 95,028,742 I273V probably benign Het
Pdpr C T 8: 111,101,900 Q12* probably null Het
Plxdc2 A G 2: 16,712,121 T339A probably benign Het
Retsat T C 6: 72,601,689 V128A probably benign Het
Rnf17 A G 14: 56,459,975 E442G probably damaging Het
Sec31b T C 19: 44,523,775 N560S probably benign Het
Slc22a16 C T 10: 40,573,840 Q91* probably null Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Slc26a4 A T 12: 31,540,513 D380E possibly damaging Het
Stc2 T A 11: 31,360,307 D243V probably benign Het
Tshz2 G T 2: 169,886,045 A385S probably damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vmn1r77 A G 7: 12,041,455 T53A probably damaging Het
Zeb2 A T 2: 44,997,445 Y518* probably null Het
Zfp760 T A 17: 21,723,010 S389T possibly damaging Het
Other mutations in Olfr134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Olfr134 APN 17 38175875 missense probably damaging 1.00
IGL01749:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01750:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01751:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01753:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01757:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01765:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01766:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01767:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01822:Olfr134 APN 17 38175448 missense probably damaging 1.00
IGL02256:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02257:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02258:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02259:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02275:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02293:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02295:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02317:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02318:Olfr134 APN 17 38175686 missense probably benign 0.04
R0230:Olfr134 UTSW 17 38175950 missense probably damaging 1.00
R0363:Olfr134 UTSW 17 38175447 missense probably damaging 1.00
R1074:Olfr134 UTSW 17 38175440 missense probably damaging 1.00
R1506:Olfr134 UTSW 17 38175200 missense probably benign
R2300:Olfr134 UTSW 17 38175550 nonsense probably null
R3743:Olfr134 UTSW 17 38175902 missense probably damaging 1.00
R3975:Olfr134 UTSW 17 38175495 missense probably benign 0.03
R4230:Olfr134 UTSW 17 38175881 missense possibly damaging 0.67
R5158:Olfr134 UTSW 17 38175454 nonsense probably null
R5439:Olfr134 UTSW 17 38176026 unclassified probably null
R6144:Olfr134 UTSW 17 38175225 missense probably damaging 1.00
R6309:Olfr134 UTSW 17 38175519 missense probably benign 0.00
R6800:Olfr134 UTSW 17 38175122 missense probably benign 0.01
R6873:Olfr134 UTSW 17 38175368 missense probably benign
R7193:Olfr134 UTSW 17 38175096 missense probably benign 0.44
X0011:Olfr134 UTSW 17 38175851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCCAGCCATTAGTATGTATC -3'
(R):5'- TGGCAATTGCTTTGGAACAATG -3'

Sequencing Primer
(F):5'- GTCCAGCCATTAGTATGTATCTTCAG -3'
(R):5'- GTAAGGATTTCTGCATGTACAAGTAC -3'
Posted On2018-07-23