Incidental Mutation 'R6676:Mia2'
ID527292
Institutional Source Beutler Lab
Gene Symbol Mia2
Ensembl Gene ENSMUSG00000021000
Gene Namemelanoma inhibitory activity 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R6676 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location59095799-59191583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59108370 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 290 (Y290H)
Ref Sequence ENSEMBL: ENSMUSP00000021384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021384] [ENSMUST00000219140]
Predicted Effect probably damaging
Transcript: ENSMUST00000021384
AA Change: Y290H

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021384
Gene: ENSMUSG00000021000
AA Change: Y290H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SH3 42 100 4.03e-2 SMART
low complexity region 288 297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219140
AA Change: Y291H

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221093
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in endoplasmic reticulum-to-Golgi trafficking and regulation of cholesterol metabolism. Three major classes of transcripts are generated from this gene- melanoma inhibitory activity 2-specific transcripts, cTAGE family member 5-specific transcripts and transcripts that include exons from both these transcript species. Additionally, alternative splicing in these transcripts results in multiple transcript variants encoding diverse isoforms. A mutation in this gene (couch-potato or cpto) may result in low levels of plasma cholesterol and triglycerides. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit decreased serum levels of cholesterol, HDL cholesterol, triglyceride, and VLDL triglyceride. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,469,915 L461P probably damaging Het
Adgra2 A T 8: 27,111,240 I303F possibly damaging Het
Cldn9 A G 17: 23,683,049 S201P probably benign Het
Clstn2 G T 9: 97,461,531 P621Q probably damaging Het
Ctdspl2 A G 2: 122,006,964 N403S probably damaging Het
Cyp2j5 T C 4: 96,635,808 Y329C possibly damaging Het
Elovl1 A G 4: 118,430,503 probably benign Het
Fam83a A G 15: 57,993,043 D206G possibly damaging Het
Fancd2 C T 6: 113,537,665 Q144* probably null Het
Fhl2 T C 1: 43,131,810 M115V possibly damaging Het
Fry T A 5: 150,380,922 D592E probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mamdc2 T A 19: 23,303,633 I684F probably damaging Het
Mup12 C T 4: 60,740,643 probably null Het
Olfr645 T C 7: 104,084,454 T209A probably benign Het
Olr1 T A 6: 129,500,077 probably null Het
Pcdhb15 T C 18: 37,474,807 V364A possibly damaging Het
Pfkp A G 13: 6,586,539 S654P possibly damaging Het
Rab3gap2 T G 1: 185,283,410 V1275G probably damaging Het
Rbbp4 A G 4: 129,328,621 F93L probably benign Het
Ripk1 T C 13: 34,010,604 V75A probably damaging Het
Scg2 T A 1: 79,435,782 Q368L possibly damaging Het
Tmprss9 A G 10: 80,898,311 probably benign Het
Other mutations in Mia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Mia2 APN 12 59160273 splice site probably benign
IGL00791:Mia2 APN 12 59108299 missense possibly damaging 0.82
IGL00821:Mia2 APN 12 59170320 critical splice donor site probably null
IGL00901:Mia2 APN 12 59108029 missense probably damaging 1.00
IGL00985:Mia2 APN 12 59188360 missense probably damaging 1.00
IGL01304:Mia2 APN 12 59104538 missense probably damaging 1.00
IGL01909:Mia2 APN 12 59107945 missense possibly damaging 0.94
IGL02646:Mia2 APN 12 59108836 missense probably damaging 1.00
IGL02800:Mia2 APN 12 59188491 nonsense probably null
IGL03332:Mia2 APN 12 59108398 missense probably damaging 0.97
PIT4812001:Mia2 UTSW 12 59101579 missense possibly damaging 0.92
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0242:Mia2 UTSW 12 59108856 missense probably damaging 1.00
R0449:Mia2 UTSW 12 59172594 critical splice donor site probably null
R0620:Mia2 UTSW 12 59154419 missense possibly damaging 0.96
R0622:Mia2 UTSW 12 59131578 missense probably damaging 0.98
R0632:Mia2 UTSW 12 59136143 missense probably damaging 0.99
R1643:Mia2 UTSW 12 59179845 splice site probably null
R1654:Mia2 UTSW 12 59108833 missense possibly damaging 0.92
R1706:Mia2 UTSW 12 59144766 nonsense probably null
R1776:Mia2 UTSW 12 59149575 splice site probably benign
R1848:Mia2 UTSW 12 59170251 splice site probably benign
R2240:Mia2 UTSW 12 59107882 missense probably benign 0.01
R2698:Mia2 UTSW 12 59170994 critical splice donor site probably null
R2860:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2861:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R2862:Mia2 UTSW 12 59154410 missense probably damaging 0.98
R3429:Mia2 UTSW 12 59189641 missense possibly damaging 0.89
R3861:Mia2 UTSW 12 59109021 missense probably benign 0.00
R3965:Mia2 UTSW 12 59176372 missense probably damaging 1.00
R5156:Mia2 UTSW 12 59172537 missense possibly damaging 0.94
R5249:Mia2 UTSW 12 59108125 missense probably damaging 0.99
R5330:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5331:Mia2 UTSW 12 59095812 missense probably benign 0.01
R5815:Mia2 UTSW 12 59174106 missense possibly damaging 0.95
R5972:Mia2 UTSW 12 59146937 missense probably damaging 1.00
R6651:Mia2 UTSW 12 59154362 missense possibly damaging 0.78
R6695:Mia2 UTSW 12 59172580 missense probably damaging 0.99
R6800:Mia2 UTSW 12 59188546 critical splice donor site probably null
R6845:Mia2 UTSW 12 59184278 nonsense probably null
R6919:Mia2 UTSW 12 59129895 missense possibly damaging 0.74
R7058:Mia2 UTSW 12 59184235 missense possibly damaging 0.77
R7209:Mia2 UTSW 12 59154390 missense possibly damaging 0.55
R7274:Mia2 UTSW 12 59108119 missense probably damaging 0.99
R7291:Mia2 UTSW 12 59158369 critical splice donor site probably null
X0063:Mia2 UTSW 12 59136139 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGCCATCCCTCAGTAAGC -3'
(R):5'- GACTTCTTCATCTGGTGGAACAG -3'

Sequencing Primer
(F):5'- TCCCTCAGTAAGCCAGAAAGG -3'
(R):5'- CAGAGCTGGGAATATCTTGTAATG -3'
Posted On2018-07-23