Incidental Mutation 'R6677:Polr1b'
ID527305
Institutional Source Beutler Lab
Gene Symbol Polr1b
Ensembl Gene ENSMUSG00000027395
Gene Namepolymerase (RNA) I polypeptide B
Synonyms128kDa, RPA116, RPA2, D630020H17Rik, Rpo1-2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_009086.2; MGI:108014

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6677 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129100995-129126594 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 129120211 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028874] [ENSMUST00000103205]
Predicted Effect unknown
Transcript: ENSMUST00000028874
AA Change: Y718H
SMART Domains Protein: ENSMUSP00000028874
Gene: ENSMUSG00000027395
AA Change: Y718H

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 437 4.6e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 8.9e-14 PFAM
Pfam:RNA_pol_Rpb2_3 455 521 1.4e-28 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103205
SMART Domains Protein: ENSMUSP00000099494
Gene: ENSMUSG00000027395

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 423 1.7e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 3.2e-11 PFAM
Pfam:RNA_pol_Rpb2_3 455 520 2.1e-29 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 4.1e-23 PFAM
Pfam:RNA_pol_Rpb2_6 670 1031 9.7e-118 PFAM
Pfam:RNA_pol_Rpb2_7 1033 1135 1.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147727
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (31/31)
MGI Phenotype Strain: 3774130
Lethality: E2-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality prior to implantation. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,534,752 H713Q possibly damaging Het
Akap9 A G 5: 4,029,869 T1874A probably benign Het
Atl1 A G 12: 69,953,444 I289M probably damaging Het
Atp12a A G 14: 56,380,854 D654G probably damaging Het
Bbox1 C A 2: 110,305,425 D70Y probably damaging Het
Blzf1 A T 1: 164,302,612 V50D possibly damaging Het
C130060K24Rik A T 6: 65,456,245 I350F probably benign Het
Cfap65 C A 1: 74,904,685 D1556Y probably damaging Het
Chrm2 A T 6: 36,524,092 N295Y probably damaging Het
Clca3b T A 3: 144,823,384 E843V probably benign Het
Enpp3 T A 10: 24,777,957 N701Y possibly damaging Het
Fbxo30 G T 10: 11,290,636 L367F possibly damaging Het
Gm4841 A T 18: 60,270,580 F147Y probably damaging Het
Gm8251 G T 1: 44,058,699 R1080S probably benign Het
Lama1 G A 17: 67,795,233 V1951I probably benign Het
Mgat4b A G 11: 50,233,071 probably null Het
Mpp3 A G 11: 102,008,618 V359A probably benign Het
Nhsl1 T A 10: 18,525,862 D911E probably damaging Het
Olfr537-ps1 T G 7: 140,538,552 F12V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Saxo2 T C 7: 82,635,276 R125G probably benign Het
Scn8a A G 15: 100,969,072 D103G probably damaging Het
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Shroom1 G A 11: 53,463,516 A88T possibly damaging Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Ssfa2 A G 2: 79,655,101 T500A possibly damaging Het
Sult5a1 A G 8: 123,149,278 F100L probably benign Het
Syne1 T C 10: 5,040,942 Q579R possibly damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Zic5 C G 14: 122,465,154 R55P unknown Het
Other mutations in Polr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Polr1b APN 2 129125909 missense probably damaging 1.00
IGL00559:Polr1b APN 2 129113731 missense probably damaging 1.00
IGL00659:Polr1b APN 2 129118100 critical splice donor site probably null
IGL00672:Polr1b APN 2 129125472 missense probably damaging 1.00
IGL01066:Polr1b APN 2 129119152 missense probably damaging 1.00
IGL01536:Polr1b APN 2 129125555 missense probably benign 0.00
IGL01596:Polr1b APN 2 129110126 missense probably benign 0.38
IGL02156:Polr1b APN 2 129123879 missense probably benign 0.40
IGL02398:Polr1b APN 2 129102966 missense probably benign 0.03
IGL02797:Polr1b APN 2 129102979 missense probably damaging 0.99
IGL02965:Polr1b APN 2 129125523 missense probably benign 0.41
IGL03009:Polr1b APN 2 129126068 missense probably damaging 1.00
IGL03092:Polr1b APN 2 129123129 missense probably damaging 1.00
IGL03129:Polr1b APN 2 129115707 missense probably benign 0.00
IGL03138:Polr1b UTSW 2 129102988 missense probably benign 0.04
PIT4362001:Polr1b UTSW 2 129109292 missense possibly damaging 0.84
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0989:Polr1b UTSW 2 129126077 missense probably damaging 0.97
R1508:Polr1b UTSW 2 129113734 missense probably benign 0.24
R1539:Polr1b UTSW 2 129118099 critical splice donor site probably null
R1700:Polr1b UTSW 2 129123121 missense probably damaging 0.99
R1843:Polr1b UTSW 2 129102966 missense probably benign 0.03
R1920:Polr1b UTSW 2 129101111 missense probably benign 0.00
R2414:Polr1b UTSW 2 129103134 splice site probably benign
R3020:Polr1b UTSW 2 129115681 missense probably benign 0.01
R3837:Polr1b UTSW 2 129119107 missense possibly damaging 0.78
R4466:Polr1b UTSW 2 129123882 missense probably benign 0.03
R4773:Polr1b UTSW 2 129105328 missense probably benign 0.29
R4789:Polr1b UTSW 2 129109337 missense probably benign 0.00
R5027:Polr1b UTSW 2 129123883 missense possibly damaging 0.94
R5579:Polr1b UTSW 2 129110108 missense probably damaging 1.00
R5705:Polr1b UTSW 2 129105351 nonsense probably null
R6303:Polr1b UTSW 2 129115762 missense probably damaging 1.00
R6313:Polr1b UTSW 2 129125446 missense probably damaging 1.00
R6427:Polr1b UTSW 2 129123261 missense probably damaging 0.99
R7033:Polr1b UTSW 2 129115642 missense possibly damaging 0.82
R7163:Polr1b UTSW 2 129126011 missense probably benign 0.44
R7184:Polr1b UTSW 2 129123922 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCGTCTGAGTCACGCTCTG -3'
(R):5'- CCTTGAAAATGCTCCAAAGTTGATC -3'

Sequencing Primer
(F):5'- GAGTCACGCTCTGAGCATTTGAC -3'
(R):5'- GTAGACCAGGCTGGCTTCAAATTC -3'
Posted On2018-07-23