Incidental Mutation 'R6677:Rnd2'
ID527322
Institutional Source Beutler Lab
Gene Symbol Rnd2
Ensembl Gene ENSMUSG00000001313
Gene NameRho family GTPase 2
SynonymsArhn, Rohn
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6677 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101464999-101471853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101468999 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 57 (L57F)
Ref Sequence ENSEMBL: ENSMUSP00000001347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]
Predicted Effect probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

DomainStartEndE-ValueType
RHO 10 184 5.22e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040430
SMART Domains Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
Pfam:ADH_N 89 157 8.8e-11 PFAM
Pfam:ADH_zinc_N 213 355 2.1e-21 PFAM
Pfam:ADH_zinc_N_2 245 398 6.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153185
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,534,752 H713Q possibly damaging Het
Akap9 A G 5: 4,029,869 T1874A probably benign Het
Atl1 A G 12: 69,953,444 I289M probably damaging Het
Atp12a A G 14: 56,380,854 D654G probably damaging Het
Bbox1 C A 2: 110,305,425 D70Y probably damaging Het
Blzf1 A T 1: 164,302,612 V50D possibly damaging Het
C130060K24Rik A T 6: 65,456,245 I350F probably benign Het
Cfap65 C A 1: 74,904,685 D1556Y probably damaging Het
Chrm2 A T 6: 36,524,092 N295Y probably damaging Het
Clca3b T A 3: 144,823,384 E843V probably benign Het
Enpp3 T A 10: 24,777,957 N701Y possibly damaging Het
Fbxo30 G T 10: 11,290,636 L367F possibly damaging Het
Gm4841 A T 18: 60,270,580 F147Y probably damaging Het
Gm8251 G T 1: 44,058,699 R1080S probably benign Het
Lama1 G A 17: 67,795,233 V1951I probably benign Het
Mgat4b A G 11: 50,233,071 probably null Het
Mpp3 A G 11: 102,008,618 V359A probably benign Het
Nhsl1 T A 10: 18,525,862 D911E probably damaging Het
Olfr537-ps1 T G 7: 140,538,552 F12V probably damaging Het
Polr1b T C 2: 129,120,211 probably benign Het
Saxo2 T C 7: 82,635,276 R125G probably benign Het
Scn8a A G 15: 100,969,072 D103G probably damaging Het
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Shroom1 G A 11: 53,463,516 A88T possibly damaging Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Ssfa2 A G 2: 79,655,101 T500A possibly damaging Het
Sult5a1 A G 8: 123,149,278 F100L probably benign Het
Syne1 T C 10: 5,040,942 Q579R possibly damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Zic5 C G 14: 122,465,154 R55P unknown Het
Other mutations in Rnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Rnd2 APN 11 101471191 missense possibly damaging 0.81
IGL01964:Rnd2 APN 11 101470806 unclassified probably null
Atkins UTSW 11 101468999 missense probably damaging 1.00
R1581:Rnd2 UTSW 11 101471196 missense probably benign
R4606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4824:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4825:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4931:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5005:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5078:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5079:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5402:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5405:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5497:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5498:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5501:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5534:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5619:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5666:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5669:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5670:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5671:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5786:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5788:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5844:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5845:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5857:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5989:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5991:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5992:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6018:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6019:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6020:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6122:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6144:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6148:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6208:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6209:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6226:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6230:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6332:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6333:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6335:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6491:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6541:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6605:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6607:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6678:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6726:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6796:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCTCAGACCAACTTCTGTC -3'
(R):5'- CCTACGTGGTTTCTGTCAGG -3'

Sequencing Primer
(F):5'- ACCAACTTCTGTCTAGGGACTGAG -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'
Posted On2018-07-23