Incidental Mutation 'R6677:Mpp3'
ID527323
Institutional Source Beutler Lab
Gene Symbol Mpp3
Ensembl Gene ENSMUSG00000052373
Gene Namemembrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3)
SynonymsDlgh3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6677 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101999652-102028461 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102008618 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 359 (V359A)
Ref Sequence ENSEMBL: ENSMUSP00000102786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062801] [ENSMUST00000100400] [ENSMUST00000107168]
Predicted Effect probably benign
Transcript: ENSMUST00000062801
AA Change: V359A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055469
Gene: ENSMUSG00000052373
AA Change: V359A

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100400
AA Change: V359A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097969
Gene: ENSMUSG00000052373
AA Change: V359A

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107168
AA Change: V359A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102786
Gene: ENSMUSG00000052373
AA Change: V359A

DomainStartEndE-ValueType
L27 10 64 1.5e-8 SMART
L27 68 121 1.18e-15 SMART
PDZ 145 218 1.06e-13 SMART
SH3 229 295 7.7e-9 SMART
GuKc 384 573 1.76e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132094
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of a family of membrane-associated proteins termed MAGUKs (membrane-associated guanylate kinase homologs). MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intracellular junctions. This protein contains a conserved sequence, called the SH3 (src homology 3) motif, found in several other proteins that associate with the cytoskeleton and are suspected to play important roles in signal transduction. Alternatively spliced transcript variants have been identified. One transcript variant is experimentally supported, but it doesn't encode a protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 G T 8: 86,534,752 H713Q possibly damaging Het
Akap9 A G 5: 4,029,869 T1874A probably benign Het
Atl1 A G 12: 69,953,444 I289M probably damaging Het
Atp12a A G 14: 56,380,854 D654G probably damaging Het
Bbox1 C A 2: 110,305,425 D70Y probably damaging Het
Blzf1 A T 1: 164,302,612 V50D possibly damaging Het
C130060K24Rik A T 6: 65,456,245 I350F probably benign Het
Cfap65 C A 1: 74,904,685 D1556Y probably damaging Het
Chrm2 A T 6: 36,524,092 N295Y probably damaging Het
Clca3b T A 3: 144,823,384 E843V probably benign Het
Enpp3 T A 10: 24,777,957 N701Y possibly damaging Het
Fbxo30 G T 10: 11,290,636 L367F possibly damaging Het
Gm4841 A T 18: 60,270,580 F147Y probably damaging Het
Gm8251 G T 1: 44,058,699 R1080S probably benign Het
Lama1 G A 17: 67,795,233 V1951I probably benign Het
Mgat4b A G 11: 50,233,071 probably null Het
Nhsl1 T A 10: 18,525,862 D911E probably damaging Het
Olfr537-ps1 T G 7: 140,538,552 F12V probably damaging Het
Polr1b T C 2: 129,120,211 probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Saxo2 T C 7: 82,635,276 R125G probably benign Het
Scn8a A G 15: 100,969,072 D103G probably damaging Het
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Shroom1 G A 11: 53,463,516 A88T possibly damaging Het
Slc24a5 G T 2: 125,080,695 A126S possibly damaging Het
Ssfa2 A G 2: 79,655,101 T500A possibly damaging Het
Sult5a1 A G 8: 123,149,278 F100L probably benign Het
Syne1 T C 10: 5,040,942 Q579R possibly damaging Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Zic5 C G 14: 122,465,154 R55P unknown Het
Other mutations in Mpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Mpp3 APN 11 102002103 missense possibly damaging 0.76
IGL01337:Mpp3 APN 11 102000585 missense probably benign
IGL01393:Mpp3 APN 11 102025478 missense probably damaging 0.99
IGL01544:Mpp3 APN 11 102018659 missense possibly damaging 0.91
IGL02152:Mpp3 APN 11 102025390 nonsense probably null
IGL02441:Mpp3 APN 11 102009675 missense probably benign 0.00
IGL02656:Mpp3 APN 11 102008601 missense probably benign
R0013:Mpp3 UTSW 11 102005425 missense probably benign 0.27
R0117:Mpp3 UTSW 11 102000573 missense probably damaging 1.00
R0564:Mpp3 UTSW 11 102005347 missense possibly damaging 0.87
R1372:Mpp3 UTSW 11 102000575 missense probably damaging 0.96
R1531:Mpp3 UTSW 11 102008649 missense probably benign
R1639:Mpp3 UTSW 11 102023442 missense probably damaging 1.00
R1720:Mpp3 UTSW 11 102025756 start codon destroyed possibly damaging 0.79
R1968:Mpp3 UTSW 11 102018552 intron probably benign
R2064:Mpp3 UTSW 11 102000690 missense probably benign 0.01
R2363:Mpp3 UTSW 11 102020486 missense probably damaging 1.00
R3775:Mpp3 UTSW 11 102023367 nonsense probably null
R3776:Mpp3 UTSW 11 102023367 nonsense probably null
R4208:Mpp3 UTSW 11 102000600 missense probably benign
R4287:Mpp3 UTSW 11 102023463 missense probably damaging 1.00
R4327:Mpp3 UTSW 11 102023511 intron probably benign
R4329:Mpp3 UTSW 11 102023511 intron probably benign
R4367:Mpp3 UTSW 11 102023420 missense probably benign 0.01
R4856:Mpp3 UTSW 11 102025136 missense probably benign
R4886:Mpp3 UTSW 11 102025136 missense probably benign
R4904:Mpp3 UTSW 11 102000587 missense probably benign 0.01
R4946:Mpp3 UTSW 11 102005022 missense probably benign 0.01
R5405:Mpp3 UTSW 11 102010221 missense probably benign
R5935:Mpp3 UTSW 11 102025415 missense probably damaging 1.00
R6020:Mpp3 UTSW 11 102018539 intron probably benign
R6056:Mpp3 UTSW 11 102011689 intron probably null
R6151:Mpp3 UTSW 11 102008566 missense probably benign 0.11
R6784:Mpp3 UTSW 11 102002148 critical splice acceptor site probably null
R6855:Mpp3 UTSW 11 102013325 missense probably benign 0.09
R7227:Mpp3 UTSW 11 102005078 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCCTTTGCTTCAGCTCATGGAG -3'
(R):5'- TTGGCCATCCAGGGTAGGAG -3'

Sequencing Primer
(F):5'- TCATGGAGGTGGGCTCC -3'
(R):5'- CCATCCAGGGTAGGAGGCTAG -3'
Posted On2018-07-23