Incidental Mutation 'R6678:Wdsub1'
ID527335
Institutional Source Beutler Lab
Gene Symbol Wdsub1
Ensembl Gene ENSMUSG00000026988
Gene NameWD repeat, SAM and U-box domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location59852364-59882591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59862631 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 313 (T313I)
Ref Sequence ENSEMBL: ENSMUSP00000028368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028368] [ENSMUST00000102751]
Predicted Effect probably benign
Transcript: ENSMUST00000028368
AA Change: T313I

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028368
Gene: ENSMUSG00000026988
AA Change: T313I

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Ubox 405 468 1.69e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102751
AA Change: T313I

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099812
Gene: ENSMUSG00000026988
AA Change: T313I

DomainStartEndE-ValueType
WD40 1 38 7.85e-7 SMART
WD40 43 82 1.96e-7 SMART
WD40 85 125 5.47e-6 SMART
WD40 128 167 1.5e-3 SMART
WD40 169 217 2.48e-4 SMART
WD40 227 266 4.91e-8 SMART
WD40 269 308 7.05e-9 SMART
SAM 327 394 1.12e-15 SMART
Pfam:U-box 402 423 9.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138519
Predicted Effect unknown
Transcript: ENSMUST00000139689
AA Change: T177I
SMART Domains Protein: ENSMUSP00000121438
Gene: ENSMUSG00000026988
AA Change: T177I

DomainStartEndE-ValueType
WD40 1 32 4.28e0 SMART
WD40 34 82 2.48e-4 SMART
WD40 92 131 4.91e-8 SMART
WD40 134 173 7.05e-9 SMART
Pfam:SAM_2 193 241 5.3e-10 PFAM
Pfam:SAM_1 194 241 2.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144823
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Wdsub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Wdsub1 APN 2 59858736 missense probably damaging 1.00
IGL02887:Wdsub1 APN 2 59852832 missense probably damaging 0.99
IGL02984:Wdsub1 UTSW 2 59876829 missense probably damaging 1.00
R0116:Wdsub1 UTSW 2 59876665 unclassified probably null
R0504:Wdsub1 UTSW 2 59878325 missense possibly damaging 0.93
R1437:Wdsub1 UTSW 2 59878133 missense probably damaging 0.98
R1452:Wdsub1 UTSW 2 59876800 missense probably null
R1566:Wdsub1 UTSW 2 59876715 missense probably damaging 1.00
R1767:Wdsub1 UTSW 2 59858714 missense probably damaging 1.00
R2938:Wdsub1 UTSW 2 59873286 missense possibly damaging 0.68
R4209:Wdsub1 UTSW 2 59876805 missense probably damaging 1.00
R4583:Wdsub1 UTSW 2 59878317 missense probably damaging 1.00
R4794:Wdsub1 UTSW 2 59862844 missense possibly damaging 0.78
R4803:Wdsub1 UTSW 2 59870399 intron probably benign
R4987:Wdsub1 UTSW 2 59870393 intron probably benign
R4989:Wdsub1 UTSW 2 59870414 intron probably benign
R5311:Wdsub1 UTSW 2 59878529 utr 5 prime probably benign
R5402:Wdsub1 UTSW 2 59870478 missense probably benign
R5408:Wdsub1 UTSW 2 59861543 unclassified probably benign
R5572:Wdsub1 UTSW 2 59862707 missense possibly damaging 0.95
R5681:Wdsub1 UTSW 2 59852895 missense probably damaging 1.00
R5864:Wdsub1 UTSW 2 59878475 missense probably damaging 1.00
R6582:Wdsub1 UTSW 2 59878308 missense probably damaging 1.00
R6638:Wdsub1 UTSW 2 59870441 intron probably benign
R6842:Wdsub1 UTSW 2 59878188 missense probably benign 0.09
R6907:Wdsub1 UTSW 2 59861684 missense possibly damaging 0.59
R7041:Wdsub1 UTSW 2 59852880 missense probably damaging 1.00
X0023:Wdsub1 UTSW 2 59876754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGCATGCAGGTTCGATCC -3'
(R):5'- CATACCAGGTCAGAAGTGAATCTC -3'

Sequencing Primer
(F):5'- TGCAGGTTCGATCCCCAGAAC -3'
(R):5'- GTAACGGCTGCATCCAT -3'
Posted On2018-07-23