Incidental Mutation 'R6678:Olfr1042'
ID527337
Institutional Source Beutler Lab
Gene Symbol Olfr1042
Ensembl Gene ENSMUSG00000075202
Gene Nameolfactory receptor 1042
SynonymsMOR185-10, GA_x6K02T2Q125-47629317-47628376
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86156743-86161838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86160185 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 62 (F62I)
Ref Sequence ENSEMBL: ENSMUSP00000151053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099907] [ENSMUST00000099908] [ENSMUST00000213886] [ENSMUST00000213949] [ENSMUST00000215624] [ENSMUST00000216028]
Predicted Effect probably benign
Transcript: ENSMUST00000099907
SMART Domains Protein: ENSMUSP00000097491
Gene: ENSMUSG00000075201

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.9e-46 PFAM
Pfam:7tm_1 41 290 1.5e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099908
AA Change: F62I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097492
Gene: ENSMUSG00000075202
AA Change: F62I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-48 PFAM
Pfam:7tm_1 41 290 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213886
Predicted Effect probably benign
Transcript: ENSMUST00000213949
Predicted Effect probably damaging
Transcript: ENSMUST00000215624
AA Change: F62I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000216028
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Olfr1042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01914:Olfr1042 APN 2 86160047 missense probably benign 0.04
IGL02071:Olfr1042 APN 2 86159875 missense probably benign
IGL02935:Olfr1042 APN 2 86160370 unclassified probably benign
IGL03152:Olfr1042 APN 2 86159686 missense possibly damaging 0.95
R0089:Olfr1042 UTSW 2 86159574 missense possibly damaging 0.89
R1419:Olfr1042 UTSW 2 86159429 makesense probably null
R1699:Olfr1042 UTSW 2 86159936 missense probably benign
R1804:Olfr1042 UTSW 2 86160073 missense probably benign 0.38
R3162:Olfr1042 UTSW 2 86160095 missense probably benign 0.03
R3162:Olfr1042 UTSW 2 86160095 missense probably benign 0.03
R3609:Olfr1042 UTSW 2 86159632 missense probably benign 0.00
R3953:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3955:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3956:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R3957:Olfr1042 UTSW 2 86159938 missense probably benign 0.02
R4771:Olfr1042 UTSW 2 86160073 missense probably benign 0.38
R5685:Olfr1042 UTSW 2 86159795 missense probably damaging 0.99
R6241:Olfr1042 UTSW 2 86160036 missense probably damaging 1.00
R6324:Olfr1042 UTSW 2 86159456 missense probably benign
R6921:Olfr1042 UTSW 2 86159852 missense probably benign 0.02
R7215:Olfr1042 UTSW 2 86159456 missense probably benign
R7386:Olfr1042 UTSW 2 86159530 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGGCCATGATTGACAGCAAG -3'
(R):5'- AGGTCGATATTGTATGCTCTGAAG -3'

Sequencing Primer
(F):5'- GCCATGATTGACAGCAAGTACAGTTC -3'
(R):5'- TCTATCTACGATGGCTAACAGC -3'
Posted On2018-07-23