Incidental Mutation 'R6678:Zyg11a'
ID527341
Institutional Source Beutler Lab
Gene Symbol Zyg11a
Ensembl Gene ENSMUSG00000034645
Gene Namezyg-11 family member A, cell cycle regulator
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108181738-108218048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108189681 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 532 (V532A)
Ref Sequence ENSEMBL: ENSMUSP00000152477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043793] [ENSMUST00000106690] [ENSMUST00000223127]
Predicted Effect probably benign
Transcript: ENSMUST00000043793
AA Change: V530A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038478
Gene: ENSMUSG00000034645
AA Change: V530A

DomainStartEndE-ValueType
SCOP:d1jdha_ 218 700 2e-11 SMART
Blast:ARM 497 544 1e-5 BLAST
Blast:ARM 547 587 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106690
AA Change: V532A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102301
Gene: ENSMUSG00000034645
AA Change: V532A

DomainStartEndE-ValueType
SCOP:d1jdha_ 139 621 1e-11 SMART
Blast:ARM 418 465 1e-5 BLAST
Blast:ARM 468 508 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000223127
AA Change: V532A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.006 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Other mutations in Zyg11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Zyg11a APN 4 108204902 missense probably damaging 0.99
IGL01517:Zyg11a APN 4 108201194 missense probably null 1.00
IGL01619:Zyg11a APN 4 108205217 missense probably damaging 1.00
IGL02253:Zyg11a APN 4 108183695 missense probably null 0.99
R0090:Zyg11a UTSW 4 108201347 splice site probably benign
R0225:Zyg11a UTSW 4 108204641 missense probably damaging 1.00
R0610:Zyg11a UTSW 4 108204857 missense probably damaging 1.00
R0827:Zyg11a UTSW 4 108210042 splice site probably benign
R1568:Zyg11a UTSW 4 108183646 critical splice donor site probably null
R1752:Zyg11a UTSW 4 108205282 missense possibly damaging 0.81
R2051:Zyg11a UTSW 4 108192047 splice site probably benign
R2358:Zyg11a UTSW 4 108196146 missense possibly damaging 0.94
R3898:Zyg11a UTSW 4 108210194 missense probably damaging 0.99
R4288:Zyg11a UTSW 4 108184469 missense probably damaging 1.00
R4381:Zyg11a UTSW 4 108201320 missense possibly damaging 0.58
R4709:Zyg11a UTSW 4 108205071 missense probably benign 0.00
R4859:Zyg11a UTSW 4 108210190 missense probably damaging 0.98
R5303:Zyg11a UTSW 4 108184432 critical splice donor site probably null
R5349:Zyg11a UTSW 4 108183732 missense probably damaging 1.00
R5363:Zyg11a UTSW 4 108189622 missense probably damaging 1.00
R5517:Zyg11a UTSW 4 108204746 missense possibly damaging 0.94
R6175:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R6254:Zyg11a UTSW 4 108181794 missense probably damaging 1.00
X0061:Zyg11a UTSW 4 108193993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGTACTTTGCTTTGTATCACAG -3'
(R):5'- TTTGAGAGCAAACTGGGGCTAG -3'

Sequencing Primer
(F):5'- AAAAGAACACTCAGGTCACTTTATC -3'
(R):5'- TGGGGCTAGAACTGAAAGGCTTC -3'
Posted On2018-07-23