Incidental Mutation 'R6678:Kmt2e'
ID527342
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6678 (G1)
Quality Score191.009
Status Validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23499295 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1162 (E1162G)
Ref Sequence ENSEMBL: ENSMUSP00000110781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088392] [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000126586] [ENSMUST00000146375] [ENSMUST00000196260]
Predicted Effect probably benign
Transcript: ENSMUST00000088392
SMART Domains Protein: ENSMUSP00000085734
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Pkinase 79 228 1.3e-22 PFAM
Pfam:Pkinase_Tyr 79 228 1e-9 PFAM
coiled coil region 263 314 N/A INTRINSIC
coiled coil region 339 373 N/A INTRINSIC
low complexity region 393 406 N/A INTRINSIC
Pfam:Pkinase 506 680 1.9e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094962
AA Change: E1162G

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: E1162G

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000115128
AA Change: E1162G

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: E1162G

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000126586
Predicted Effect probably benign
Transcript: ENSMUST00000146375
SMART Domains Protein: ENSMUSP00000142547
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194010
Predicted Effect probably benign
Transcript: ENSMUST00000196260
SMART Domains Protein: ENSMUSP00000143791
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197591
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCAGTTGGCAACTTTGTGG -3'
(R):5'- AGGACAGTTACTGCTGCCTTC -3'

Sequencing Primer
(F):5'- TAAGACCTAGGTTCGAATCCCGG -3'
(R):5'- TTCTTCAGAAGAGGCACTGTAAGC -3'
Posted On2018-07-23