Incidental Mutation 'R6678:Gm43302'
ID527343
Institutional Source Beutler Lab
Gene Symbol Gm43302
Ensembl Gene ENSMUSG00000079362
Gene Namepredicted gene 43302
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105214907-105293695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105290954 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 23 (Q23K)
Ref Sequence ENSEMBL: ENSMUSP00000142518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000196520] [ENSMUST00000200045]
Predicted Effect probably benign
Transcript: ENSMUST00000050011
AA Change: Q23K

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362
AA Change: Q23K

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196520
AA Change: Q23K

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142518
Gene: ENSMUSG00000104713
AA Change: Q23K

DomainStartEndE-ValueType
Pfam:GBP 16 279 2.8e-124 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199944
Predicted Effect probably benign
Transcript: ENSMUST00000200045
AA Change: Q23K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142994
Gene: ENSMUSG00000104713
AA Change: Q23K

DomainStartEndE-ValueType
Pfam:GBP 16 62 7.4e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Gm43302
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Gm43302 UTSW 5 105276844 missense probably benign 0.12
R0066:Gm43302 UTSW 5 105290900 missense probably damaging 1.00
R0764:Gm43302 UTSW 5 105280489 missense probably benign
R1400:Gm43302 UTSW 5 105274756 missense probably damaging 1.00
R1421:Gm43302 UTSW 5 105217349 missense probably benign
R1539:Gm43302 UTSW 5 105274769 missense probably benign 0.02
R1774:Gm43302 UTSW 5 105275794 missense probably benign 0.01
R1842:Gm43302 UTSW 5 105277736 missense probably benign 0.01
R2011:Gm43302 UTSW 5 105290980 missense probably damaging 1.00
R2131:Gm43302 UTSW 5 105274744 missense probably damaging 0.99
R2174:Gm43302 UTSW 5 105274350 missense probably benign 0.12
R3687:Gm43302 UTSW 5 105280266 missense probably damaging 1.00
R5322:Gm43302 UTSW 5 105217481 missense probably benign 0.00
R5396:Gm43302 UTSW 5 105280089 nonsense probably null
R5668:Gm43302 UTSW 5 105275812 missense probably benign
R5723:Gm43302 UTSW 5 105217486 missense possibly damaging 0.89
R6073:Gm43302 UTSW 5 105290959 missense probably damaging 0.96
R6159:Gm43302 UTSW 5 105289028 missense probably benign 0.11
R6225:Gm43302 UTSW 5 105277739 nonsense probably null
R6483:Gm43302 UTSW 5 105275860 missense probably benign 0.01
R6537:Gm43302 UTSW 5 105290995 missense possibly damaging 0.94
R6889:Gm43302 UTSW 5 105280138 missense probably benign 0.00
R7163:Gm43302 UTSW 5 105293627 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAAGGGATTCAATTTAGCATGGG -3'
(R):5'- CATTTGAGGCTATGCGCTGC -3'

Sequencing Primer
(F):5'- GGCTTTGCTAAAAAGGAGTTCTACTG -3'
(R):5'- TATGCGCTGCCAACAGG -3'
Posted On2018-07-23