Incidental Mutation 'R6678:Kcnc1'
ID527347
Institutional Source Beutler Lab
Gene Symbol Kcnc1
Ensembl Gene ENSMUSG00000058975
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 1
SynonymsKv3.1, C230009H10Rik, Kcr2-1, KShIIIB, NGK2, KV4, Shaw
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6678 (G1)
Quality Score119.008
Status Validated
Chromosome7
Chromosomal Location46396497-46438704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46397805 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 43 (H43R)
Ref Sequence ENSEMBL: ENSMUSP00000124938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025202] [ENSMUST00000160433]
Predicted Effect probably benign
Transcript: ENSMUST00000025202
AA Change: H43R

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025202
Gene: ENSMUSG00000058975
AA Change: H43R

DomainStartEndE-ValueType
BTB 8 112 2.29e-15 SMART
low complexity region 125 149 N/A INTRINSIC
Pfam:Ion_trans 247 435 2.8e-34 PFAM
Pfam:Ion_trans_2 346 440 1.5e-12 PFAM
low complexity region 449 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160433
AA Change: H43R

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124938
Gene: ENSMUSG00000058975
AA Change: H43R

DomainStartEndE-ValueType
BTB 8 112 2.29e-15 SMART
low complexity region 125 149 N/A INTRINSIC
Pfam:Ion_trans 189 447 6.9e-47 PFAM
Pfam:Ion_trans_2 347 440 1.4e-12 PFAM
low complexity region 449 464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of integral membrane proteins that mediate the voltage-dependent potassium ion permeability of excitable membranes. Alternative splicing is thought to result in two transcript variants encoding isoforms that differ at their C-termini. These isoforms have had conflicting names in the literature: the longer isoform has been called both "b" and "alpha", while the shorter isoform has been called both "a" and "beta" (PMIDs 1432046, 12091563). [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Kcnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Kcnc1 APN 7 46428099 missense possibly damaging 0.95
IGL01860:Kcnc1 APN 7 46428130 missense probably damaging 1.00
IGL02075:Kcnc1 APN 7 46427973 missense probably damaging 1.00
IGL02478:Kcnc1 APN 7 46435169 missense probably benign 0.18
wispy UTSW 7 46427397 missense probably damaging 1.00
R1438:Kcnc1 UTSW 7 46428267 missense possibly damaging 0.81
R1487:Kcnc1 UTSW 7 46397874 missense possibly damaging 0.88
R1487:Kcnc1 UTSW 7 46435348 critical splice donor site probably null
R1595:Kcnc1 UTSW 7 46427586 missense probably benign 0.03
R2273:Kcnc1 UTSW 7 46427802 missense probably damaging 1.00
R2345:Kcnc1 UTSW 7 46397946 missense probably damaging 1.00
R4126:Kcnc1 UTSW 7 46398002 missense probably damaging 0.98
R4387:Kcnc1 UTSW 7 46397702 missense possibly damaging 0.89
R4388:Kcnc1 UTSW 7 46397702 missense possibly damaging 0.89
R4508:Kcnc1 UTSW 7 46428288 missense probably benign 0.15
R4688:Kcnc1 UTSW 7 46397835 missense probably benign 0.01
R4784:Kcnc1 UTSW 7 46437287 missense probably benign 0.00
R5293:Kcnc1 UTSW 7 46397811 missense probably benign 0.01
R5993:Kcnc1 UTSW 7 46427532 missense probably damaging 1.00
R6296:Kcnc1 UTSW 7 46435316 missense probably benign 0.00
R6512:Kcnc1 UTSW 7 46427397 missense probably damaging 1.00
R6801:Kcnc1 UTSW 7 46435292 missense probably damaging 0.99
R7232:Kcnc1 UTSW 7 46427959 missense probably damaging 1.00
X0022:Kcnc1 UTSW 7 46435240 missense probably benign
X0054:Kcnc1 UTSW 7 46397892 missense probably damaging 1.00
Y5406:Kcnc1 UTSW 7 46427379 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTAGGCGCCTTAAAGACC -3'
(R):5'- ATAGGTCATCCAGCAGCAGG -3'

Sequencing Primer
(F):5'- TAGGCGCCTTAAAGACCCTAGG -3'
(R):5'- ATCCAGCAGCAGGGCTCC -3'
Posted On2018-07-23