Incidental Mutation 'R6678:Lrp1'
ID527351
Institutional Source Beutler Lab
Gene Symbol Lrp1
Ensembl Gene ENSMUSG00000040249
Gene Namelow density lipoprotein receptor-related protein 1
SynonymsA2mr, b2b1554Clo, CD91
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_008512.2; MGI:96828

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6678 (G1)
Quality Score221.009
Status Validated
Chromosome10
Chromosomal Location127538161-127621148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127560136 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 2422 (H2422Y)
Ref Sequence ENSEMBL: ENSMUSP00000044004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049149]
Predicted Effect probably damaging
Transcript: ENSMUST00000049149
AA Change: H2422Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044004
Gene: ENSMUSG00000040249
AA Change: H2422Y

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
LDLa 27 67 1.03e-15 SMART
LDLa 72 111 1.04e-11 SMART
EGF 115 150 8.78e-2 SMART
EGF_CA 151 190 4.49e-8 SMART
low complexity region 222 232 N/A INTRINSIC
LY 273 315 7.07e-6 SMART
LY 316 359 2.31e-10 SMART
LY 360 402 8.3e-12 SMART
EGF 478 521 9.93e-1 SMART
LY 552 594 8.84e-7 SMART
LY 595 638 6.54e-10 SMART
LY 641 690 2.5e-15 SMART
LY 691 734 1.06e-9 SMART
EGF 807 844 1.38e1 SMART
LDLa 854 893 3.39e-16 SMART
LDLa 895 934 1.73e-13 SMART
LDLa 936 974 4.47e-16 SMART
LDLa 976 1014 2.53e-15 SMART
LDLa 1015 1054 2.95e-16 SMART
LDLa 1062 1100 3.24e-13 SMART
LDLa 1104 1143 2.97e-12 SMART
LDLa 1145 1185 1.24e-9 SMART
EGF 1185 1223 4.97e-1 SMART
EGF 1227 1263 6.02e0 SMART
LY 1290 1332 3.76e-1 SMART
LY 1337 1379 8.56e-14 SMART
LY 1380 1424 8.43e-13 SMART
LY 1425 1469 3.05e-10 SMART
LY 1471 1513 3.88e-3 SMART
EGF 1540 1580 1.85e0 SMART
LY 1606 1650 2.83e-5 SMART
LY 1651 1695 2.01e-10 SMART
LY 1698 1735 1.87e-5 SMART
LY 1736 1777 3.54e-6 SMART
LY 1778 1820 4.17e1 SMART
EGF 1850 1888 1.24e-1 SMART
LY 1915 1957 3.2e-4 SMART
LY 1958 2000 2.33e-15 SMART
LY 2001 2044 7.45e-14 SMART
LY 2045 2087 3.87e-12 SMART
LY 2089 2131 1.37e0 SMART
EGF 2159 2196 1.66e1 SMART
LY 2276 2318 5.57e-4 SMART
LY 2324 2369 3.3e-6 SMART
LY 2370 2412 3.93e-13 SMART
LY 2413 2454 3.62e-3 SMART
EGF_like 2482 2519 3.16e1 SMART
LDLa 2524 2564 3.31e-10 SMART
LDLa 2566 2603 7.21e-11 SMART
LDLa 2605 2642 1.09e-10 SMART
LDLa 2660 2691 6.05e-4 SMART
LDLa 2696 2733 2.49e-14 SMART
LDLa 2734 2772 4.65e-14 SMART
LDLa 2774 2815 3.92e-12 SMART
LDLa 2818 2856 1.51e-13 SMART
LDLa 2858 2900 1.93e-11 SMART
LDLa 2904 2942 1.73e-13 SMART
EGF_CA 2941 2982 6.16e-6 SMART
EGF_CA 2983 3023 2.66e-10 SMART
LY 3050 3094 6.64e-11 SMART
LY 3095 3137 7.17e-16 SMART
LY 3138 3181 4.28e-14 SMART
LY 3182 3224 8.11e-15 SMART
LY 3225 3265 1.44e-6 SMART
EGF 3294 3332 1.02e-2 SMART
LDLa 3334 3372 2.25e-12 SMART
LDLa 3374 3411 9.81e-13 SMART
LDLa 3413 3451 9.81e-13 SMART
LDLa 3453 3492 5.67e-18 SMART
LDLa 3494 3534 7.15e-15 SMART
LDLa 3536 3573 1.79e-15 SMART
EGF_like 3575 3611 4.83e1 SMART
LDLa 3575 3612 1.92e-15 SMART
LDLa 3613 3650 1.18e-15 SMART
LDLa 3654 3693 7.55e-14 SMART
LDLa 3695 3734 1.14e-8 SMART
LDLa 3741 3779 6.28e-11 SMART
EGF 3785 3824 1.06e1 SMART
EGF 3828 3862 1.51e0 SMART
LY 3893 3935 9.43e0 SMART
LY 3951 3993 1.23e-14 SMART
LY 3994 4037 2.98e-13 SMART
LY 4038 4080 4.28e-14 SMART
EGF 4151 4184 3.76e-1 SMART
low complexity region 4185 4198 N/A INTRINSIC
EGF 4200 4233 3.82e-2 SMART
EGF 4236 4269 4.03e-1 SMART
EGF 4272 4305 5.2e-4 SMART
EGF 4308 4341 1.22e0 SMART
EGF_like 4344 4376 4.11e1 SMART
EGF 4377 4410 5.12e-3 SMART
transmembrane domain 4423 4445 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype Strain: 2178192
Lethality: E10-E13
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor family of proteins. The encoded preproprotein is proteolytically processed by furin to generate 515 kDa and 85 kDa subunits that form the mature receptor (PMID: 8546712). This receptor is involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the alpha 2-macroglobulin-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer's disease patients. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality during late organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(42) : Targeted(9) Gene trapped(33)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Lrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Lrp1 APN 10 127542205 missense possibly damaging 0.89
IGL01065:Lrp1 APN 10 127575038 missense probably benign 0.10
IGL01121:Lrp1 APN 10 127583853 nonsense probably null
IGL01360:Lrp1 APN 10 127545820 missense possibly damaging 0.93
IGL01402:Lrp1 APN 10 127595032 missense probably damaging 1.00
IGL01404:Lrp1 APN 10 127595032 missense probably damaging 1.00
IGL01411:Lrp1 APN 10 127581765 nonsense probably null
IGL01469:Lrp1 APN 10 127584414 missense probably damaging 1.00
IGL01552:Lrp1 APN 10 127588510 nonsense probably null
IGL01682:Lrp1 APN 10 127574978 missense probably benign 0.00
IGL01760:Lrp1 APN 10 127573501 missense probably benign 0.00
IGL01918:Lrp1 APN 10 127554589 missense probably damaging 0.99
IGL01989:Lrp1 APN 10 127578129 missense probably damaging 1.00
IGL02105:Lrp1 APN 10 127544579 missense probably damaging 1.00
IGL02158:Lrp1 APN 10 127554271 missense probably benign 0.02
IGL02164:Lrp1 APN 10 127563667 missense probably benign 0.39
IGL02337:Lrp1 APN 10 127576887 missense possibly damaging 0.87
IGL02425:Lrp1 APN 10 127571887 critical splice donor site probably null
IGL02493:Lrp1 APN 10 127581778 missense probably damaging 0.99
IGL02563:Lrp1 APN 10 127551686 missense probably damaging 1.00
IGL02590:Lrp1 APN 10 127552791 missense probably damaging 1.00
IGL02624:Lrp1 APN 10 127572422 missense probably damaging 0.98
IGL02625:Lrp1 APN 10 127574486 missense probably damaging 1.00
IGL02825:Lrp1 APN 10 127542605 missense probably damaging 1.00
IGL02880:Lrp1 APN 10 127540222 missense probably benign 0.12
IGL02900:Lrp1 APN 10 127576647 splice site probably benign
IGL02956:Lrp1 APN 10 127544559 missense probably benign 0.00
IGL02974:Lrp1 APN 10 127555016 missense probably damaging 0.99
IGL02983:Lrp1 APN 10 127550199 missense probably damaging 1.00
IGL03002:Lrp1 APN 10 127589636 missense probably damaging 1.00
IGL03091:Lrp1 APN 10 127559124 missense probably benign 0.30
IGL03109:Lrp1 APN 10 127566645 missense probably benign
IGL03194:Lrp1 APN 10 127568685 missense probably damaging 1.00
IGL03232:Lrp1 APN 10 127539376 missense probably damaging 1.00
peripheral UTSW 10 127610381 missense probably damaging 1.00
tangential UTSW 10 127593848 missense probably damaging 0.99
P0015:Lrp1 UTSW 10 127566663 missense probably damaging 0.99
PIT4519001:Lrp1 UTSW 10 127607974 missense possibly damaging 0.91
PIT4520001:Lrp1 UTSW 10 127607974 missense possibly damaging 0.91
R0004:Lrp1 UTSW 10 127541825 splice site probably null
R0034:Lrp1 UTSW 10 127545651 missense probably benign 0.42
R0091:Lrp1 UTSW 10 127540979 missense probably damaging 1.00
R0098:Lrp1 UTSW 10 127552738 missense probably benign
R0098:Lrp1 UTSW 10 127552738 missense probably benign
R0143:Lrp1 UTSW 10 127593942 missense probably damaging 1.00
R0372:Lrp1 UTSW 10 127592136 missense probably damaging 1.00
R0379:Lrp1 UTSW 10 127594969 missense probably damaging 1.00
R0445:Lrp1 UTSW 10 127590636 nonsense probably null
R0529:Lrp1 UTSW 10 127541594 intron probably null
R0551:Lrp1 UTSW 10 127571958 missense probably benign
R0570:Lrp1 UTSW 10 127555009 nonsense probably null
R0600:Lrp1 UTSW 10 127567383 missense probably benign 0.00
R0626:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R0647:Lrp1 UTSW 10 127571477 missense probably damaging 1.00
R0680:Lrp1 UTSW 10 127589661 missense probably damaging 1.00
R0792:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R0792:Lrp1 UTSW 10 127575286 missense probably benign 0.04
R0848:Lrp1 UTSW 10 127553362 splice site probably null
R0866:Lrp1 UTSW 10 127539278 missense probably damaging 1.00
R0918:Lrp1 UTSW 10 127593965 missense probably damaging 1.00
R1076:Lrp1 UTSW 10 127563797 splice site probably benign
R1107:Lrp1 UTSW 10 127557435 missense probably damaging 1.00
R1346:Lrp1 UTSW 10 127605866 missense probably damaging 1.00
R1403:Lrp1 UTSW 10 127581891 critical splice acceptor site probably null
R1403:Lrp1 UTSW 10 127581891 critical splice acceptor site probably null
R1496:Lrp1 UTSW 10 127539011 missense probably damaging 1.00
R1522:Lrp1 UTSW 10 127567364 missense probably damaging 1.00
R1522:Lrp1 UTSW 10 127575286 missense probably benign 0.04
R1525:Lrp1 UTSW 10 127539529 missense probably damaging 1.00
R1539:Lrp1 UTSW 10 127584381 unclassified probably null
R1589:Lrp1 UTSW 10 127605606 missense probably benign 0.00
R1591:Lrp1 UTSW 10 127605606 missense probably benign 0.00
R1663:Lrp1 UTSW 10 127556921 missense probably damaging 1.00
R1682:Lrp1 UTSW 10 127574332 missense probably damaging 1.00
R1717:Lrp1 UTSW 10 127556269 missense possibly damaging 0.59
R1717:Lrp1 UTSW 10 127563665 missense probably damaging 1.00
R1758:Lrp1 UTSW 10 127588584 missense possibly damaging 0.76
R1826:Lrp1 UTSW 10 127553707 missense probably damaging 1.00
R1842:Lrp1 UTSW 10 127573468 missense possibly damaging 0.93
R1844:Lrp1 UTSW 10 127595283 critical splice donor site probably null
R1845:Lrp1 UTSW 10 127578673 missense probably damaging 1.00
R1896:Lrp1 UTSW 10 127559998 missense possibly damaging 0.64
R1952:Lrp1 UTSW 10 127567431 missense probably damaging 1.00
R2009:Lrp1 UTSW 10 127544516 missense probably damaging 1.00
R2015:Lrp1 UTSW 10 127540694 missense probably benign 0.00
R2116:Lrp1 UTSW 10 127576493 nonsense probably null
R2161:Lrp1 UTSW 10 127555738 missense probably damaging 1.00
R2199:Lrp1 UTSW 10 127546840 missense probably damaging 1.00
R2213:Lrp1 UTSW 10 127540702 missense probably damaging 1.00
R2300:Lrp1 UTSW 10 127556915 nonsense probably null
R2324:Lrp1 UTSW 10 127566586 missense possibly damaging 0.92
R2849:Lrp1 UTSW 10 127542296 missense probably damaging 1.00
R2926:Lrp1 UTSW 10 127588113 missense probably damaging 0.98
R2993:Lrp1 UTSW 10 127610381 missense probably damaging 1.00
R3522:Lrp1 UTSW 10 127553555 missense probably damaging 1.00
R3702:Lrp1 UTSW 10 127595103 missense probably damaging 1.00
R3789:Lrp1 UTSW 10 127571969 missense possibly damaging 0.94
R3898:Lrp1 UTSW 10 127592100 nonsense probably null
R3941:Lrp1 UTSW 10 127553396 missense probably damaging 1.00
R3958:Lrp1 UTSW 10 127571958 missense probably benign
R4369:Lrp1 UTSW 10 127550286 missense possibly damaging 0.87
R4510:Lrp1 UTSW 10 127593848 missense probably damaging 0.99
R4511:Lrp1 UTSW 10 127593848 missense probably damaging 0.99
R4576:Lrp1 UTSW 10 127540188 small deletion probably benign
R4583:Lrp1 UTSW 10 127541372 missense probably benign 0.00
R4662:Lrp1 UTSW 10 127552185 nonsense probably null
R4721:Lrp1 UTSW 10 127555059 missense possibly damaging 0.58
R4728:Lrp1 UTSW 10 127563737 missense probably damaging 1.00
R4745:Lrp1 UTSW 10 127549944 missense probably benign 0.20
R4785:Lrp1 UTSW 10 127558133 missense probably benign 0.12
R4841:Lrp1 UTSW 10 127583936 missense probably damaging 1.00
R4842:Lrp1 UTSW 10 127583936 missense probably damaging 1.00
R4855:Lrp1 UTSW 10 127610442 missense probably benign 0.03
R4860:Lrp1 UTSW 10 127553824 missense probably damaging 1.00
R4860:Lrp1 UTSW 10 127553824 missense probably damaging 1.00
R4891:Lrp1 UTSW 10 127541752 missense probably damaging 1.00
R4925:Lrp1 UTSW 10 127575075 nonsense probably null
R4970:Lrp1 UTSW 10 127539520 missense probably benign 0.11
R4999:Lrp1 UTSW 10 127553779 missense probably damaging 1.00
R5044:Lrp1 UTSW 10 127567495 missense probably damaging 1.00
R5127:Lrp1 UTSW 10 127539634 intron probably benign
R5188:Lrp1 UTSW 10 127607952 missense probably damaging 1.00
R5218:Lrp1 UTSW 10 127548619 missense probably damaging 1.00
R5225:Lrp1 UTSW 10 127556096 missense probably benign 0.04
R5291:Lrp1 UTSW 10 127593878 missense probably damaging 1.00
R5386:Lrp1 UTSW 10 127592114 missense probably damaging 1.00
R5395:Lrp1 UTSW 10 127595297 missense probably damaging 1.00
R5413:Lrp1 UTSW 10 127588067 critical splice donor site probably null
R5430:Lrp1 UTSW 10 127541061 missense probably damaging 0.99
R5499:Lrp1 UTSW 10 127572944 missense possibly damaging 0.58
R5526:Lrp1 UTSW 10 127555724 missense probably benign 0.37
R5580:Lrp1 UTSW 10 127588520 missense probably benign
R5583:Lrp1 UTSW 10 127588463 missense probably benign 0.08
R5599:Lrp1 UTSW 10 127593869 missense probably damaging 1.00
R5639:Lrp1 UTSW 10 127593839 missense probably damaging 0.99
R5677:Lrp1 UTSW 10 127574429 missense probably damaging 1.00
R5730:Lrp1 UTSW 10 127583834 missense probably benign 0.00
R5742:Lrp1 UTSW 10 127548347 missense probably damaging 0.98
R5764:Lrp1 UTSW 10 127595318 missense probably benign 0.41
R5864:Lrp1 UTSW 10 127567505 missense possibly damaging 0.58
R5937:Lrp1 UTSW 10 127583876 missense possibly damaging 0.93
R5947:Lrp1 UTSW 10 127589554 critical splice donor site probably null
R5976:Lrp1 UTSW 10 127583901 missense probably damaging 1.00
R6021:Lrp1 UTSW 10 127578014 missense probably damaging 1.00
R6026:Lrp1 UTSW 10 127573403 missense probably damaging 1.00
R6045:Lrp1 UTSW 10 127566600 missense probably damaging 0.98
R6057:Lrp1 UTSW 10 127567490 missense probably damaging 1.00
R6084:Lrp1 UTSW 10 127560553 missense probably benign 0.09
R6131:Lrp1 UTSW 10 127560157 missense probably benign
R6235:Lrp1 UTSW 10 127588177 missense probably damaging 1.00
R6280:Lrp1 UTSW 10 127589584 missense probably benign 0.04
R6307:Lrp1 UTSW 10 127592075 missense probably damaging 1.00
R6532:Lrp1 UTSW 10 127541682 missense probably damaging 1.00
R6532:Lrp1 UTSW 10 127549407 missense probably damaging 1.00
R6536:Lrp1 UTSW 10 127558068 splice site probably null
R6605:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6607:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6631:Lrp1 UTSW 10 127574332 missense probably damaging 1.00
R6676:Lrp1 UTSW 10 127560136 missense probably damaging 1.00
R6809:Lrp1 UTSW 10 127555056 missense probably benign 0.04
R6884:Lrp1 UTSW 10 127559117 missense probably benign 0.00
R6925:Lrp1 UTSW 10 127556988 missense probably benign 0.00
R6987:Lrp1 UTSW 10 127575005 missense probably damaging 1.00
R7016:Lrp1 UTSW 10 127559967 critical splice donor site probably null
R7030:Lrp1 UTSW 10 127552876 missense probably damaging 0.97
R7053:Lrp1 UTSW 10 127541094 missense probably damaging 1.00
R7076:Lrp1 UTSW 10 127550183 critical splice donor site probably null
R7136:Lrp1 UTSW 10 127558622 missense probably damaging 1.00
R7180:Lrp1 UTSW 10 127556965 missense probably damaging 1.00
R7199:Lrp1 UTSW 10 127573456 missense probably damaging 0.99
R7219:Lrp1 UTSW 10 127557228 missense probably benign 0.40
R7233:Lrp1 UTSW 10 127595061 missense probably damaging 1.00
R7251:Lrp1 UTSW 10 127572554 missense probably damaging 1.00
R7264:Lrp1 UTSW 10 127592093 missense probably damaging 1.00
R7302:Lrp1 UTSW 10 127538987 missense probably benign 0.01
R7313:Lrp1 UTSW 10 127553468 missense probably damaging 1.00
R7322:Lrp1 UTSW 10 127545564 missense probably benign 0.24
R7354:Lrp1 UTSW 10 127571408 missense probably damaging 1.00
R7375:Lrp1 UTSW 10 127539348 missense probably damaging 1.00
R7388:Lrp1 UTSW 10 127583897 nonsense probably null
R7404:Lrp1 UTSW 10 127582708 missense
R7405:Lrp1 UTSW 10 127581751 missense possibly damaging 0.93
R7477:Lrp1 UTSW 10 127568920 missense probably damaging 1.00
V3553:Lrp1 UTSW 10 127571442 missense probably damaging 1.00
Y5406:Lrp1 UTSW 10 127554283 missense probably damaging 1.00
Z1088:Lrp1 UTSW 10 127584379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGTGCAGGCAGAGATC -3'
(R):5'- GCGTGGTTCTGACAACACTTAG -3'

Sequencing Primer
(F):5'- TGGTAGCCCCACTCACAG -3'
(R):5'- CGTGGTTCTGACAACACTTAGAAAAG -3'
Posted On2018-07-23