Incidental Mutation 'R6678:Ndel1'
ID527353
Institutional Source Beutler Lab
Gene Symbol Ndel1
Ensembl Gene ENSMUSG00000018736
Gene NamenudE neurodevelopment protein 1 like 1
Synonyms2600006O07Rik, mNudel
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68821434-68871858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68833413 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 245 (T245A)
Ref Sequence ENSEMBL: ENSMUSP00000104312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018880] [ENSMUST00000101017] [ENSMUST00000108672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018880
AA Change: T245A

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000018880
Gene: ENSMUSG00000018736
AA Change: T245A

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
Pfam:NUDE_C 135 309 6.6e-49 PFAM
low complexity region 322 339 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101017
AA Change: T245A

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098579
Gene: ENSMUSG00000018736
AA Change: T245A

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
Pfam:NUDE_C 135 315 9.3e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108672
AA Change: T245A

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104312
Gene: ENSMUSG00000018736
AA Change: T245A

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
Pfam:NUDE_C 135 315 9.3e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144300
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil protein that plays a role in multiple processes including cytoskeletal organization, cell signaling and neuron migration, outgrowth and maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous inactivation of this gene causes peri-implantation lethality. Blastocysts fail to grow in culture and exhibit inner cell mass degeneration. Compound heterozygous mice carrying one null and one hypomorphic allele show mild neuronal migration defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Ndel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03236:Ndel1 APN 11 68842150 missense probably benign 0.05
FR4342:Ndel1 UTSW 11 68833409 missense probably damaging 0.97
R0025:Ndel1 UTSW 11 68836173 missense probably damaging 0.97
R0088:Ndel1 UTSW 11 68833420 missense probably damaging 0.98
R1510:Ndel1 UTSW 11 68822656 missense possibly damaging 0.80
R1944:Ndel1 UTSW 11 68829920 missense probably benign
R4710:Ndel1 UTSW 11 68845337 missense probably damaging 0.99
R5940:Ndel1 UTSW 11 68822571 utr 3 prime probably benign
R6293:Ndel1 UTSW 11 68836275 missense probably damaging 1.00
R7043:Ndel1 UTSW 11 68822624 missense possibly damaging 0.70
R7107:Ndel1 UTSW 11 68822648 missense possibly damaging 0.90
X0013:Ndel1 UTSW 11 68839988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAGGTAACCTTGAAGCCCAG -3'
(R):5'- CAGTTTGGAGAAGTGACCACTG -3'

Sequencing Primer
(F):5'- CCAGGCTGGGGGTTTTCTCAG -3'
(R):5'- AGTGACCACTGATGTAGTCTAATGG -3'
Posted On2018-07-23