Incidental Mutation 'R6678:Rnd2'
ID527354
Institutional Source Beutler Lab
Gene Symbol Rnd2
Ensembl Gene ENSMUSG00000001313
Gene NameRho family GTPase 2
SynonymsArhn, Rohn
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101464999-101471853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101468999 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 57 (L57F)
Ref Sequence ENSEMBL: ENSMUSP00000001347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]
Predicted Effect probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

DomainStartEndE-ValueType
RHO 10 184 5.22e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040430
SMART Domains Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
Pfam:ADH_N 89 157 8.8e-11 PFAM
Pfam:ADH_zinc_N 213 355 2.1e-21 PFAM
Pfam:ADH_zinc_N_2 245 398 6.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153185
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Rnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Rnd2 APN 11 101471191 missense possibly damaging 0.81
IGL01964:Rnd2 APN 11 101470806 unclassified probably null
Atkins UTSW 11 101468999 missense probably damaging 1.00
R1581:Rnd2 UTSW 11 101471196 missense probably benign
R4606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4824:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4825:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4931:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5005:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5078:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5079:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5402:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5405:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5497:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5498:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5501:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5534:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5619:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5666:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5669:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5670:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5671:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5786:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5788:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5844:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5845:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5857:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5989:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5991:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5992:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6018:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6019:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6020:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6122:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6144:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6148:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6208:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6209:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6226:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6230:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6332:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6333:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6335:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6491:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6541:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6605:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6607:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6677:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6726:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6796:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTGTCTAGGGACTGAGCTG -3'
(R):5'- GGGCCGATATTAGACTTCCTACG -3'

Sequencing Primer
(F):5'- TCTAGGGACTGAGCTGGACCG -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'
Posted On2018-07-23