Incidental Mutation 'R6678:Gm8765'
ID527356
Institutional Source Beutler Lab
Gene Symbol Gm8765
Ensembl Gene ENSMUSG00000094918
Gene Namepredicted gene 8765
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6678 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location50698312-50703435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50701910 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 528 (K528R)
Ref Sequence ENSEMBL: ENSMUSP00000097118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099518]
Predicted Effect probably benign
Transcript: ENSMUST00000099518
AA Change: K528R

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097118
Gene: ENSMUSG00000094918
AA Change: K528R

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
Pfam:FAM75 95 418 1.1e-15 PFAM
SCOP:d1i5pa1 811 874 9e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Sh3bp1 T C 15: 78,908,514 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Gm8765
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gm8765 APN 13 50700378 missense probably benign 0.18
IGL02452:Gm8765 APN 13 50703077 missense probably damaging 0.99
IGL02610:Gm8765 APN 13 50701712 missense possibly damaging 0.91
IGL03171:Gm8765 APN 13 50702352 missense probably benign 0.23
IGL03369:Gm8765 APN 13 50703164 missense possibly damaging 0.74
PIT4382001:Gm8765 UTSW 13 50700971 missense probably damaging 0.99
R0346:Gm8765 UTSW 13 50703310 missense probably benign 0.12
R1015:Gm8765 UTSW 13 50701628 missense possibly damaging 0.92
R1054:Gm8765 UTSW 13 50702396 missense probably benign 0.01
R1102:Gm8765 UTSW 13 50703082 missense probably benign 0.00
R1519:Gm8765 UTSW 13 50700407 critical splice donor site probably null
R1628:Gm8765 UTSW 13 50702288 missense probably benign 0.25
R1754:Gm8765 UTSW 13 50701087 missense probably damaging 0.98
R4212:Gm8765 UTSW 13 50700352 missense possibly damaging 0.94
R4672:Gm8765 UTSW 13 50703172 missense probably benign
R4780:Gm8765 UTSW 13 50701080 missense probably damaging 0.97
R4794:Gm8765 UTSW 13 50703239 missense probably benign 0.07
R5171:Gm8765 UTSW 13 50700378 missense possibly damaging 0.85
R6240:Gm8765 UTSW 13 50701417 missense probably damaging 0.97
R6366:Gm8765 UTSW 13 50701936 missense probably benign 0.01
R6421:Gm8765 UTSW 13 50701951 missense probably benign 0.35
R6644:Gm8765 UTSW 13 50702035 missense possibly damaging 0.54
R6788:Gm8765 UTSW 13 50703095 missense probably damaging 0.99
R7030:Gm8765 UTSW 13 50702983 missense possibly damaging 0.52
R7513:Gm8765 UTSW 13 50702873 missense not run
Predicted Primers PCR Primer
(F):5'- CGCCCATCTGCAATTCCAAG -3'
(R):5'- AGGGCCTTCCATTGTCATAC -3'

Sequencing Primer
(F):5'- ATCTGCAATTCCAAGGCTGC -3'
(R):5'- ATTGTCATACACCATGGGCG -3'
Posted On2018-07-23