Incidental Mutation 'R6678:Sh3bp1'
ID527359
Institutional Source Beutler Lab
Gene Symbol Sh3bp1
Ensembl Gene ENSMUSG00000022436
Gene NameSH3-domain binding protein 1
Synonyms3BP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6678 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location78899768-78912051 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 78908514 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001226] [ENSMUST00000061239] [ENSMUST00000109698] [ENSMUST00000132047] [ENSMUST00000134703] [ENSMUST00000151146]
Predicted Effect probably null
Transcript: ENSMUST00000001226
SMART Domains Protein: ENSMUSP00000001226
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 7e-37 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
low complexity region 558 593 N/A INTRINSIC
low complexity region 604 633 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000061239
SMART Domains Protein: ENSMUSP00000052181
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109698
SMART Domains Protein: ENSMUSP00000105320
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132047
SMART Domains Protein: ENSMUSP00000138598
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 254 5.4e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150472
Predicted Effect probably benign
Transcript: ENSMUST00000151146
SMART Domains Protein: ENSMUSP00000138780
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 143 9e-22 PFAM
low complexity region 160 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231057
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 T C 1: 25,460,810 N644S possibly damaging Het
Agl C A 3: 116,753,320 V1294F probably damaging Het
Ash2l A C 8: 25,833,777 W125G probably damaging Het
Dap C T 15: 31,273,250 T51M probably benign Het
Dnah12 G A 14: 26,735,692 R871H probably damaging Het
Filip1l T C 16: 57,569,970 I307T probably benign Het
Gdap1l1 T A 2: 163,438,654 S37T probably benign Het
Gm43302 G T 5: 105,290,954 Q23K probably benign Het
Gm8765 A G 13: 50,701,910 K528R probably benign Het
Golga2 T C 2: 32,299,060 V227A probably damaging Het
Gramd4 A T 15: 86,091,503 S74C probably damaging Het
Gramd4 G C 15: 86,091,504 S74T possibly damaging Het
Hsph1 A C 5: 149,618,497 S755A probably benign Het
Inppl1 A G 7: 101,832,270 V235A probably damaging Het
Kcnc1 A G 7: 46,397,805 H43R probably benign Het
Klhl41 T G 2: 69,670,844 S216R probably benign Het
Kmt2e A G 5: 23,499,295 E1162G possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Ms4a13 T C 19: 11,183,858 I106V probably benign Het
Myo1f G A 17: 33,575,845 D20N probably damaging Het
Ndel1 T C 11: 68,833,413 T245A possibly damaging Het
Olfr1042 A T 2: 86,160,185 F62I probably damaging Het
P2rx6 C A 16: 17,570,956 N360K probably benign Het
Pcdhgb5 C T 18: 37,731,202 L17F probably damaging Het
Plcl1 A G 1: 55,695,776 K92R probably benign Het
Prelp C T 1: 133,914,775 D211N probably benign Het
Rgl1 T C 1: 152,524,724 Y677C probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 G T 13: 37,899,699 D113Y probably damaging Het
Sf1 T A 19: 6,374,513 probably null Het
Shprh T A 10: 11,166,545 D757E probably benign Het
Slc6a1 A G 6: 114,307,776 K81R probably benign Het
Ttc22 T A 4: 106,623,045 S165R probably benign Het
Vmn1r113 G A 7: 20,787,978 G232S probably benign Het
Vwa7 C A 17: 35,019,800 A288D probably damaging Het
Wdpcp A G 11: 21,721,105 I449V probably benign Het
Wdsub1 G A 2: 59,862,631 T313I probably benign Het
Zyg11a A G 4: 108,189,681 V532A probably benign Het
Other mutations in Sh3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Sh3bp1 APN 15 78905114 missense possibly damaging 0.58
IGL01879:Sh3bp1 APN 15 78907992 missense probably damaging 1.00
IGL02112:Sh3bp1 APN 15 78905884 critical splice donor site probably null
IGL02216:Sh3bp1 APN 15 78905164 missense probably benign 0.07
IGL02385:Sh3bp1 APN 15 78905888 splice site probably benign
IGL02417:Sh3bp1 APN 15 78901499 missense probably damaging 1.00
IGL02551:Sh3bp1 APN 15 78904338 missense probably benign 0.01
PIT1430001:Sh3bp1 UTSW 15 78914024 missense probably benign
PIT4585001:Sh3bp1 UTSW 15 78910076 missense possibly damaging 0.49
R0255:Sh3bp1 UTSW 15 78904334 nonsense probably null
R0318:Sh3bp1 UTSW 15 78911707 missense probably damaging 0.97
R0544:Sh3bp1 UTSW 15 78905775 missense probably damaging 1.00
R0554:Sh3bp1 UTSW 15 78907267 missense probably damaging 1.00
R1424:Sh3bp1 UTSW 15 78903699 critical splice donor site probably null
R1465:Sh3bp1 UTSW 15 78907345 splice site probably benign
R1813:Sh3bp1 UTSW 15 78903680 missense probably damaging 0.96
R1835:Sh3bp1 UTSW 15 78905150 missense probably damaging 1.00
R2291:Sh3bp1 UTSW 15 78918319 missense possibly damaging 0.93
R2415:Sh3bp1 UTSW 15 78901161 start gained probably benign
R2509:Sh3bp1 UTSW 15 78911506 missense probably damaging 1.00
R2511:Sh3bp1 UTSW 15 78911506 missense probably damaging 1.00
R3054:Sh3bp1 UTSW 15 78911422 missense probably benign 0.01
R3827:Sh3bp1 UTSW 15 78904497 missense possibly damaging 0.67
R3855:Sh3bp1 UTSW 15 78901161 start gained probably benign
R4767:Sh3bp1 UTSW 15 78904497 missense possibly damaging 0.67
R4787:Sh3bp1 UTSW 15 78907995 missense possibly damaging 0.80
R4852:Sh3bp1 UTSW 15 78904338 missense probably benign 0.01
R4872:Sh3bp1 UTSW 15 78908037 missense probably benign 0.31
R5194:Sh3bp1 UTSW 15 78903101 missense probably damaging 1.00
R6320:Sh3bp1 UTSW 15 78911515 missense probably damaging 1.00
R6322:Sh3bp1 UTSW 15 78911515 missense probably damaging 1.00
R6569:Sh3bp1 UTSW 15 78911696 missense probably damaging 1.00
R6905:Sh3bp1 UTSW 15 78905030 missense probably benign 0.00
R7564:Sh3bp1 UTSW 15 78911560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTTGACCCCTGTTCATACC -3'
(R):5'- AGTTGTAAATCCCACTGTCCC -3'

Sequencing Primer
(F):5'- GACCCCTGTTCATACCATCTCTAG -3'
(R):5'- TTCTCAGGAAATGAACAATGCCTGG -3'
Posted On2018-07-23