Mutagenetix > Incidental Mutation

Incidental Mutation 'R6679:Adgrb3'

527368

Institutional Source

Beutler Lab

Gene Symbol

Adgrb3

Ensembl Gene

ENSMUSG00000033569

Gene Name

adhesion G protein-coupled receptor B3

Synonyms

Bai3, A830096D10Rik

MMRRC Submission

044798-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.409) question?

Stock #

R6679 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25106557-25868788 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25170377 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 767 (I767V)

Ref Sequence

ENSEMBL: ENSMUSP00000116759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000126626] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]

AlphaFold

Q80ZF8

Predicted Effect

probably benign
Transcript: ENSMUST00000041838
AA Change: I974V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: I974V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126096

Predicted Effect

probably benign
Transcript: ENSMUST00000126626
AA Change: I104V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000115442
Gene: ENSMUSG00000033569
AA Change: I104V

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	273	7.3e-65	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000135518
AA Change: I974V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: I974V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:DUF3497	586	810	1.7e-52	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	874	1143	2.1e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146592
AA Change: I767V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: I767V

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
TSP1	87	136	2.1e-12	SMART
TSP1	141	191	7.97e-13	SMART
TSP1	196	246	6.28e-11	SMART
TSP1	251	301	1.48e-7	SMART
HormR	303	369	4.15e-20	SMART
Pfam:DUF3497	379	603	2.5e-52	PFAM
GPS	608	661	1.24e-21	SMART
Pfam:7tm_2	667	903	5.4e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000151309
AA Change: I974V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: I974V

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
TSP1	294	343	2.1e-12	SMART
TSP1	348	398	7.97e-13	SMART
TSP1	403	453	6.28e-11	SMART
TSP1	458	508	1.48e-7	SMART
HormR	510	576	4.15e-20	SMART
Pfam:GAIN	589	794	1.1e-44	PFAM
GPS	815	868	1.24e-21	SMART
Pfam:7tm_2	875	1143	2.7e-63	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154102

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.9%

Validation Efficiency

91% (40/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	A	5: 146,441,750 (GRCm39)	V299E	probably damaging	Het
Ahnak2	G	A	12: 112,739,410 (GRCm39)	T748I	probably damaging	Het
Aoc3	T	A	11: 101,222,279 (GRCm39)	L129M	probably damaging	Het
Arhgef7	T	A	8: 11,874,667 (GRCm39)	M540K	possibly damaging	Het
Bod1l	T	A	5: 41,974,009 (GRCm39)	K2435M	probably damaging	Het
Col11a1	A	G	3: 113,946,368 (GRCm39)		probably null	Het
Col5a3	C	T	9: 20,690,329 (GRCm39)	G1162R	probably damaging	Het
Creb5	G	T	6: 53,662,454 (GRCm39)	M250I	possibly damaging	Het
Dnase1l1	C	T	X: 73,320,644 (GRCm39)		probably null	Homo
Dock10	A	G	1: 80,544,514 (GRCm39)	I557T	probably benign	Het
Efcab2	G	A	1: 178,264,969 (GRCm39)	A12T	probably benign	Het
Ehd1	A	G	19: 6,344,474 (GRCm39)	N245D	probably benign	Het
Erich3	T	A	3: 154,468,066 (GRCm39)	D839E	possibly damaging	Het
Fam13b	T	C	18: 34,620,075 (GRCm39)	T270A	possibly damaging	Het
Fat2	A	T	11: 55,200,131 (GRCm39)	L981Q	probably damaging	Het
Fgfrl1	G	A	5: 108,852,838 (GRCm39)	W89*	probably null	Het
Fgfrl1	G	T	5: 108,852,839 (GRCm39)	W89C	probably damaging	Het
Gm10770	G	A	2: 150,021,569 (GRCm39)	P11S	probably damaging	Het
Gm10801	TC	TCGGC	2: 98,494,151 (GRCm39)		probably benign	Het
Hdac3	A	G	18: 38,077,986 (GRCm39)	V190A	possibly damaging	Het
Htr1a	A	G	13: 105,581,936 (GRCm39)	N392S	probably damaging	Het
Ift43	A	G	12: 86,185,592 (GRCm39)	M59V	probably benign	Het
Jakmip2	T	C	18: 43,699,014 (GRCm39)	T482A	probably damaging	Het
Myo1c	C	T	11: 75,562,461 (GRCm39)	P918S	probably benign	Het
Nme8	A	T	13: 19,875,140 (GRCm39)		probably null	Het
Or5h26	A	G	16: 58,988,209 (GRCm39)	I99T	probably benign	Het
Peg10	CCAACAACAACAACAACAACAACA	CCAACAACAACAACAACAACA	6: 4,754,276 (GRCm39)		probably benign	Het
Plec	A	G	15: 76,058,015 (GRCm39)	F3996S	probably damaging	Het
Ppfia4	A	T	1: 134,237,417 (GRCm39)	Y961N	probably damaging	Het
Rag1	G	A	2: 101,474,629 (GRCm39)	P171L	probably damaging	Het
Rbm24	A	T	13: 46,572,468 (GRCm39)		probably benign	Het
Rsf1	A	AAGGCGACGG	7: 97,229,111 (GRCm39)		probably null	Het
Rxfp3	T	C	15: 11,035,956 (GRCm39)	Y472C	probably damaging	Het
Sash1	T	A	10: 8,615,949 (GRCm39)	I638F	probably damaging	Het
Sh3glb2	G	A	2: 30,240,631 (GRCm39)	R145W	probably damaging	Het
Ston2	G	T	12: 91,614,870 (GRCm39)	P513T	probably damaging	Het
Sycp2	A	G	2: 178,022,721 (GRCm39)	M470T	probably damaging	Het
Syt10	C	A	15: 89,698,574 (GRCm39)	D257Y	probably damaging	Het
Tcfl5	G	T	2: 180,277,055 (GRCm39)	L447I	probably damaging	Het
Tlr11	T	C	14: 50,600,311 (GRCm39)	W766R	probably benign	Het
Usp33	T	A	3: 152,074,124 (GRCm39)	D19E	possibly damaging	Het
Vmn1r123	T	A	7: 20,896,868 (GRCm39)	Y253*	probably null	Het
Wdr55	G	A	18: 36,896,177 (GRCm39)	G289D	probably damaging	Het
Zfp523	C	T	17: 28,421,194 (GRCm39)	T235M	probably damaging	Het

Other mutations in Adgrb3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Adgrb3	APN	1	25,267,581 (GRCm39)	missense	probably benign	0.09
IGL00507:Adgrb3	APN	1	25,113,796 (GRCm39)	missense	possibly damaging	0.93
IGL00828:Adgrb3	APN	1	25,527,200 (GRCm39)	missense	possibly damaging	0.73
IGL01285:Adgrb3	APN	1	25,132,868 (GRCm39)	missense	probably benign	0.32
IGL01309:Adgrb3	APN	1	25,151,352 (GRCm39)	missense	possibly damaging	0.69
IGL01540:Adgrb3	APN	1	25,151,252 (GRCm39)	splice site	probably null
IGL01608:Adgrb3	APN	1	25,592,855 (GRCm39)	missense	probably damaging	1.00
IGL01638:Adgrb3	APN	1	25,598,832 (GRCm39)	splice site	probably benign
IGL01657:Adgrb3	APN	1	25,865,574 (GRCm39)	missense	probably benign	0.03
IGL01666:Adgrb3	APN	1	25,499,832 (GRCm39)	missense	probably damaging	0.96
IGL01712:Adgrb3	APN	1	25,865,360 (GRCm39)	missense	probably benign
IGL01767:Adgrb3	APN	1	25,598,895 (GRCm39)	missense	probably benign	0.00
IGL01987:Adgrb3	APN	1	25,140,512 (GRCm39)	critical splice donor site	probably null
IGL02201:Adgrb3	APN	1	25,459,631 (GRCm39)	splice site	probably benign
IGL02584:Adgrb3	APN	1	25,544,065 (GRCm39)	missense	probably damaging	0.98
IGL02685:Adgrb3	APN	1	25,123,323 (GRCm39)	critical splice donor site	probably null
IGL02886:Adgrb3	APN	1	25,543,991 (GRCm39)	splice site	probably null
IGL02929:Adgrb3	APN	1	25,592,905 (GRCm39)	missense	probably benign	0.00
IGL03153:Adgrb3	APN	1	25,570,978 (GRCm39)	nonsense	probably null
IGL03165:Adgrb3	APN	1	25,133,475 (GRCm39)	missense	probably benign	0.05
IGL03227:Adgrb3	APN	1	25,586,556 (GRCm39)	missense	probably damaging	1.00
IGL03392:Adgrb3	APN	1	25,543,529 (GRCm39)	missense	probably damaging	0.99
schwach	UTSW	1	25,150,772 (GRCm39)	critical splice donor site	probably null
R0007:Adgrb3	UTSW	1	25,150,772 (GRCm39)	critical splice donor site	probably null
R0048:Adgrb3	UTSW	1	25,140,563 (GRCm39)	missense	probably benign	0.02
R0048:Adgrb3	UTSW	1	25,140,563 (GRCm39)	missense	probably benign	0.02
R0322:Adgrb3	UTSW	1	25,260,829 (GRCm39)	splice site	probably benign
R0442:Adgrb3	UTSW	1	25,435,551 (GRCm39)	missense	probably damaging	0.96
R0563:Adgrb3	UTSW	1	25,586,635 (GRCm39)	missense	probably damaging	0.99
R1168:Adgrb3	UTSW	1	25,865,280 (GRCm39)	missense	probably benign
R1252:Adgrb3	UTSW	1	25,167,909 (GRCm39)	missense	probably damaging	1.00
R1264:Adgrb3	UTSW	1	25,598,931 (GRCm39)	missense	probably damaging	0.97
R1543:Adgrb3	UTSW	1	25,527,169 (GRCm39)	missense	probably benign	0.01
R1577:Adgrb3	UTSW	1	25,133,264 (GRCm39)	missense	possibly damaging	0.51
R1581:Adgrb3	UTSW	1	25,133,153 (GRCm39)	missense	possibly damaging	0.94
R1583:Adgrb3	UTSW	1	25,265,912 (GRCm39)	splice site	probably null
R1653:Adgrb3	UTSW	1	25,140,584 (GRCm39)	missense	probably benign	0.09
R1725:Adgrb3	UTSW	1	25,865,381 (GRCm39)	missense	probably damaging	1.00
R1792:Adgrb3	UTSW	1	25,267,552 (GRCm39)	missense	probably damaging	1.00
R1827:Adgrb3	UTSW	1	25,571,658 (GRCm39)	missense	probably damaging	0.99
R1838:Adgrb3	UTSW	1	25,123,351 (GRCm39)	missense	probably damaging	1.00
R1869:Adgrb3	UTSW	1	25,865,519 (GRCm39)	missense	possibly damaging	0.83
R1971:Adgrb3	UTSW	1	25,586,525 (GRCm39)	missense	probably benign	0.02
R2005:Adgrb3	UTSW	1	25,150,799 (GRCm39)	missense	probably benign	0.25
R2134:Adgrb3	UTSW	1	25,133,038 (GRCm39)	missense	probably damaging	0.99
R2142:Adgrb3	UTSW	1	25,107,290 (GRCm39)	missense	probably damaging	1.00
R2268:Adgrb3	UTSW	1	25,150,898 (GRCm39)	missense	possibly damaging	0.79
R3740:Adgrb3	UTSW	1	25,865,535 (GRCm39)	missense	probably benign	0.00
R3877:Adgrb3	UTSW	1	25,150,906 (GRCm39)	missense	probably damaging	1.00
R4120:Adgrb3	UTSW	1	25,133,388 (GRCm39)	nonsense	probably null
R4344:Adgrb3	UTSW	1	25,865,829 (GRCm39)	missense	possibly damaging	0.61
R4363:Adgrb3	UTSW	1	25,151,303 (GRCm39)	missense	probably damaging	1.00
R4438:Adgrb3	UTSW	1	25,870,108 (GRCm39)	unclassified	probably benign
R4465:Adgrb3	UTSW	1	25,133,447 (GRCm39)	missense	probably damaging	1.00
R4480:Adgrb3	UTSW	1	25,150,829 (GRCm39)	missense	probably damaging	1.00
R4554:Adgrb3	UTSW	1	25,123,360 (GRCm39)	missense	probably damaging	1.00
R4557:Adgrb3	UTSW	1	25,123,360 (GRCm39)	missense	probably damaging	1.00
R4622:Adgrb3	UTSW	1	25,865,569 (GRCm39)	missense	probably damaging	0.99
R4713:Adgrb3	UTSW	1	25,586,613 (GRCm39)	missense	probably damaging	1.00
R4772:Adgrb3	UTSW	1	25,570,956 (GRCm39)	missense	probably damaging	1.00
R4890:Adgrb3	UTSW	1	25,260,908 (GRCm39)	missense	probably damaging	1.00
R5045:Adgrb3	UTSW	1	25,113,860 (GRCm39)	missense	probably damaging	1.00
R5061:Adgrb3	UTSW	1	25,107,209 (GRCm39)	utr 3 prime	probably benign
R5097:Adgrb3	UTSW	1	25,865,165 (GRCm39)	missense	probably damaging	1.00
R5227:Adgrb3	UTSW	1	25,133,033 (GRCm39)	missense	possibly damaging	0.55
R5241:Adgrb3	UTSW	1	25,150,871 (GRCm39)	missense	possibly damaging	0.85
R5328:Adgrb3	UTSW	1	25,133,356 (GRCm39)	missense	possibly damaging	0.90
R5372:Adgrb3	UTSW	1	25,167,940 (GRCm39)	missense	probably benign	0.01
R5703:Adgrb3	UTSW	1	25,459,640 (GRCm39)	missense	probably damaging	1.00
R5747:Adgrb3	UTSW	1	25,865,643 (GRCm39)	missense	probably damaging	1.00
R5998:Adgrb3	UTSW	1	25,470,582 (GRCm39)	splice site	probably null
R6006:Adgrb3	UTSW	1	25,865,612 (GRCm39)	missense	possibly damaging	0.85
R6077:Adgrb3	UTSW	1	25,133,081 (GRCm39)	nonsense	probably null
R6183:Adgrb3	UTSW	1	25,133,451 (GRCm39)	missense	probably damaging	0.98
R6190:Adgrb3	UTSW	1	25,459,728 (GRCm39)	missense	probably benign	0.01
R6249:Adgrb3	UTSW	1	25,471,639 (GRCm39)	missense	probably damaging	1.00
R6310:Adgrb3	UTSW	1	25,150,799 (GRCm39)	missense	probably benign	0.13
R6450:Adgrb3	UTSW	1	25,459,683 (GRCm39)	missense	probably benign
R6678:Adgrb3	UTSW	1	25,499,891 (GRCm39)	missense	possibly damaging	0.84
R6685:Adgrb3	UTSW	1	25,150,817 (GRCm39)	nonsense	probably null
R6730:Adgrb3	UTSW	1	25,133,375 (GRCm39)	missense	probably damaging	1.00
R6805:Adgrb3	UTSW	1	25,865,253 (GRCm39)	missense	possibly damaging	0.83
R6847:Adgrb3	UTSW	1	25,133,003 (GRCm39)	missense	probably benign	0.03
R6929:Adgrb3	UTSW	1	25,150,852 (GRCm39)	nonsense	probably null
R6953:Adgrb3	UTSW	1	25,865,592 (GRCm39)	missense	probably damaging	1.00
R7062:Adgrb3	UTSW	1	25,865,166 (GRCm39)	missense	possibly damaging	0.90
R7244:Adgrb3	UTSW	1	25,170,350 (GRCm39)	missense	probably damaging	1.00
R7292:Adgrb3	UTSW	1	25,570,957 (GRCm39)	missense	probably damaging	1.00
R7325:Adgrb3	UTSW	1	25,571,711 (GRCm39)	missense	probably benign	0.01
R7378:Adgrb3	UTSW	1	25,571,000 (GRCm39)	nonsense	probably null
R7489:Adgrb3	UTSW	1	25,586,586 (GRCm39)	missense	probably damaging	1.00
R7615:Adgrb3	UTSW	1	25,137,978 (GRCm39)	missense	probably damaging	1.00
R7623:Adgrb3	UTSW	1	25,586,629 (GRCm39)	missense	probably damaging	1.00
R7787:Adgrb3	UTSW	1	25,471,625 (GRCm39)	missense	probably damaging	1.00
R7837:Adgrb3	UTSW	1	25,167,915 (GRCm39)	missense	probably damaging	1.00
R8064:Adgrb3	UTSW	1	25,459,637 (GRCm39)	critical splice donor site	probably null
R8152:Adgrb3	UTSW	1	25,260,838 (GRCm39)	splice site	probably null
R8161:Adgrb3	UTSW	1	25,133,003 (GRCm39)	missense	probably benign	0.03
R8225:Adgrb3	UTSW	1	25,865,597 (GRCm39)	missense	probably benign	0.00
R8417:Adgrb3	UTSW	1	25,527,134 (GRCm39)	missense	probably benign	0.21
R8694:Adgrb3	UTSW	1	25,865,472 (GRCm39)	missense	probably damaging	0.98
R8742:Adgrb3	UTSW	1	25,265,835 (GRCm39)	missense	probably benign	0.01
R8886:Adgrb3	UTSW	1	25,150,928 (GRCm39)	missense	probably damaging	1.00
R8941:Adgrb3	UTSW	1	25,133,235 (GRCm39)	missense	probably damaging	1.00
R8958:Adgrb3	UTSW	1	25,865,190 (GRCm39)	missense	possibly damaging	0.68
R8979:Adgrb3	UTSW	1	25,527,115 (GRCm39)	missense	probably benign	0.03
R9064:Adgrb3	UTSW	1	25,570,965 (GRCm39)	missense	possibly damaging	0.86
R9252:Adgrb3	UTSW	1	25,865,496 (GRCm39)	missense	probably benign	0.03
R9401:Adgrb3	UTSW	1	25,592,783 (GRCm39)	missense	probably damaging	1.00
R9739:Adgrb3	UTSW	1	25,592,849 (GRCm39)	missense	probably damaging	1.00
Z1088:Adgrb3	UTSW	1	25,170,352 (GRCm39)	missense	probably damaging	1.00
Z1176:Adgrb3	UTSW	1	25,132,995 (GRCm39)	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- CAAAGTTCCAAATGACCTCATGG -3'
(R):5'- AAGAAGAGAGCAGTCCAGTCTC -3'

Sequencing Primer
(F):5'- CCAAATGACCTCATGGATGTTCAG -3'
(R):5'- AGCAGTCCAGTCTCTGAGTCTTAG -3'

Posted On

2018-07-23