Incidental Mutation 'R6679:Erich3'
ID527380
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Nameglutamate rich 3
Synonyms4922501L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R6679 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location154663859-154767790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154762429 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 839 (D839E)
Ref Sequence ENSEMBL: ENSMUSP00000096097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098496] [ENSMUST00000189969]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098496
AA Change: D839E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161
AA Change: D839E

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189969
SMART Domains Protein: ENSMUSP00000140929
Gene: ENSMUSG00000078161

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,940 V299E probably damaging Het
Adgrb3 T C 1: 25,131,296 I767V probably benign Het
Ahnak2 G A 12: 112,772,976 T748I probably damaging Het
Aoc3 T A 11: 101,331,453 L129M probably damaging Het
Arhgef7 T A 8: 11,824,667 M540K possibly damaging Het
Bod1l T A 5: 41,816,666 K2435M probably damaging Het
Col11a1 A G 3: 114,152,719 probably null Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Creb5 G T 6: 53,685,469 M250I possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock10 A G 1: 80,566,797 I557T probably benign Het
Efcab2 G A 1: 178,437,404 A12T probably benign Het
Ehd1 A G 19: 6,294,444 N245D probably benign Het
Fam13b T C 18: 34,487,022 T270A possibly damaging Het
Fat2 A T 11: 55,309,305 L981Q probably damaging Het
Fgfrl1 G A 5: 108,704,972 W89* probably null Het
Fgfrl1 G T 5: 108,704,973 W89C probably damaging Het
Gm10770 G A 2: 150,179,649 P11S probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Hdac3 A G 18: 37,944,933 V190A possibly damaging Het
Htr1a A G 13: 105,445,428 N392S probably damaging Het
Ift43 A G 12: 86,138,818 M59V probably benign Het
Jakmip2 T C 18: 43,565,949 T482A probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme8 A T 13: 19,690,970 probably null Het
Olfr196 A G 16: 59,167,846 I99T probably benign Het
Peg10 CCAACAACAACAACAACAACAACA CCAACAACAACAACAACAACA 6: 4,754,276 probably benign Het
Plec A G 15: 76,173,815 F3996S probably damaging Het
Ppfia4 A T 1: 134,309,679 Y961N probably damaging Het
Rag1 G A 2: 101,644,284 P171L probably damaging Het
Rbm24 A T 13: 46,418,992 probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rxfp3 T C 15: 11,035,870 Y472C probably damaging Het
Sash1 T A 10: 8,740,185 I638F probably damaging Het
Sh3glb2 G A 2: 30,350,619 R145W probably damaging Het
Ston2 G T 12: 91,648,096 P513T probably damaging Het
Sycp2 A G 2: 178,380,928 M470T probably damaging Het
Syt10 C A 15: 89,814,371 D257Y probably damaging Het
Tcfl5 G T 2: 180,635,262 L447I probably damaging Het
Tlr11 T C 14: 50,362,854 W766R probably benign Het
Usp33 T A 3: 152,368,487 D19E possibly damaging Het
Vmn1r123 T A 7: 21,162,943 Y253* probably null Het
Wdr55 G A 18: 36,763,124 G289D probably damaging Het
Zfp523 C T 17: 28,202,220 T235M probably damaging Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154748519 missense probably benign 0.44
IGL01141:Erich3 APN 3 154714016 missense probably benign 0.08
IGL01812:Erich3 APN 3 154713971 missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154713962 missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154727477 missense probably damaging 0.97
IGL03386:Erich3 APN 3 154739239 missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154763513 unclassified probably benign
R0942:Erich3 UTSW 3 154739151 missense probably benign 0.00
R1558:Erich3 UTSW 3 154714068 missense probably damaging 0.99
R1582:Erich3 UTSW 3 154764323 unclassified probably benign
R1674:Erich3 UTSW 3 154762623 unclassified probably benign
R1676:Erich3 UTSW 3 154762623 unclassified probably benign
R1724:Erich3 UTSW 3 154762327 missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154695765 missense probably damaging 0.98
R1771:Erich3 UTSW 3 154748472 missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154764651 missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154733603 missense probably damaging 0.98
R2507:Erich3 UTSW 3 154698659 missense probably null 1.00
R3621:Erich3 UTSW 3 154748732 missense possibly damaging 0.83
R3755:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764578 missense possibly damaging 0.66
R3832:Erich3 UTSW 3 154762361 missense probably damaging 0.97
R4020:Erich3 UTSW 3 154714049 missense probably damaging 0.97
R4601:Erich3 UTSW 3 154764738 missense unknown
R4628:Erich3 UTSW 3 154763687 missense probably damaging 1.00
R4841:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154764804 missense unknown
R4989:Erich3 UTSW 3 154748388 missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154763580 missense probably damaging 1.00
R5596:Erich3 UTSW 3 154727396 missense probably damaging 0.99
R5695:Erich3 UTSW 3 154733573 missense probably damaging 1.00
R5742:Erich3 UTSW 3 154733323 missense probably damaging 1.00
R5859:Erich3 UTSW 3 154762497 missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154695823 missense probably damaging 1.00
R6172:Erich3 UTSW 3 154764341 missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154727502 missense probably damaging 1.00
R6438:Erich3 UTSW 3 154695753 missense probably damaging 1.00
R6520:Erich3 UTSW 3 154763465 missense probably damaging 0.98
R6697:Erich3 UTSW 3 154764270 unclassified probably benign
R6800:Erich3 UTSW 3 154727392 critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154727437 missense probably damaging 1.00
R6855:Erich3 UTSW 3 154762649 nonsense probably null
R6989:Erich3 UTSW 3 154763677 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCCCAGCCTGAGGATAC -3'
(R):5'- GGGGATGACAGGTACCATCTTC -3'

Sequencing Primer
(F):5'- TGCTGGCATAGATGTGGA -3'
(R):5'- ACATCCATGTTAGCATCCTGGGG -3'
Posted On2018-07-23