Incidental Mutation 'R6679:Fgfrl1'
ID527382
Institutional Source Beutler Lab
Gene Symbol Fgfrl1
Ensembl Gene ENSMUSG00000008090
Gene Namefibroblast growth factor receptor-like 1
SynonymsFGFR5, FGFR5beta, FGFR5gamma, fibroblast growth factor receptor 5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6679 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108692382-108706924 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 108704972 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 89 (W89*)
Ref Sequence ENSEMBL: ENSMUSP00000108179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013633] [ENSMUST00000112560] [ENSMUST00000196222] [ENSMUST00000197255]
Predicted Effect probably null
Transcript: ENSMUST00000013633
AA Change: W180*
SMART Domains Protein: ENSMUSP00000013633
Gene: ENSMUSG00000008090
AA Change: W180*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 2.64e-12 SMART
low complexity region 117 131 N/A INTRINSIC
IGc2 159 224 1.35e-18 SMART
IGc2 255 341 6.16e-4 SMART
transmembrane domain 372 394 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112560
AA Change: W89*
SMART Domains Protein: ENSMUSP00000108179
Gene: ENSMUSG00000008090
AA Change: W89*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 40 N/A INTRINSIC
IGc2 68 133 1.35e-18 SMART
IGc2 164 250 6.16e-4 SMART
transmembrane domain 281 303 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196222
SMART Domains Protein: ENSMUSP00000143037
Gene: ENSMUSG00000008090

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 1.1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199802
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death due to respiratory distress, a malformed diaphragm, and lack of metanephric kidneys. Homozygotes for a different null allele show both fetal and neonatal death, a similar diaphragm defect, as well as cardiac and skeletal defects, and fetal anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,940 V299E probably damaging Het
Adgrb3 T C 1: 25,131,296 I767V probably benign Het
Ahnak2 G A 12: 112,772,976 T748I probably damaging Het
Aoc3 T A 11: 101,331,453 L129M probably damaging Het
Arhgef7 T A 8: 11,824,667 M540K possibly damaging Het
Bod1l T A 5: 41,816,666 K2435M probably damaging Het
Col11a1 A G 3: 114,152,719 probably null Het
Col5a3 C T 9: 20,779,033 G1162R probably damaging Het
Creb5 G T 6: 53,685,469 M250I possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Dock10 A G 1: 80,566,797 I557T probably benign Het
Efcab2 G A 1: 178,437,404 A12T probably benign Het
Ehd1 A G 19: 6,294,444 N245D probably benign Het
Erich3 T A 3: 154,762,429 D839E possibly damaging Het
Fam13b T C 18: 34,487,022 T270A possibly damaging Het
Fat2 A T 11: 55,309,305 L981Q probably damaging Het
Gm10770 G A 2: 150,179,649 P11S probably damaging Het
Gm10801 TC TCGGC 2: 98,663,806 probably benign Het
Hdac3 A G 18: 37,944,933 V190A possibly damaging Het
Htr1a A G 13: 105,445,428 N392S probably damaging Het
Ift43 A G 12: 86,138,818 M59V probably benign Het
Jakmip2 T C 18: 43,565,949 T482A probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nme8 A T 13: 19,690,970 probably null Het
Olfr196 A G 16: 59,167,846 I99T probably benign Het
Peg10 CCAACAACAACAACAACAACAACA CCAACAACAACAACAACAACA 6: 4,754,276 probably benign Het
Plec A G 15: 76,173,815 F3996S probably damaging Het
Ppfia4 A T 1: 134,309,679 Y961N probably damaging Het
Rag1 G A 2: 101,644,284 P171L probably damaging Het
Rbm24 A T 13: 46,418,992 probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Rxfp3 T C 15: 11,035,870 Y472C probably damaging Het
Sash1 T A 10: 8,740,185 I638F probably damaging Het
Sh3glb2 G A 2: 30,350,619 R145W probably damaging Het
Ston2 G T 12: 91,648,096 P513T probably damaging Het
Sycp2 A G 2: 178,380,928 M470T probably damaging Het
Syt10 C A 15: 89,814,371 D257Y probably damaging Het
Tcfl5 G T 2: 180,635,262 L447I probably damaging Het
Tlr11 T C 14: 50,362,854 W766R probably benign Het
Usp33 T A 3: 152,368,487 D19E possibly damaging Het
Vmn1r123 T A 7: 21,162,943 Y253* probably null Het
Wdr55 G A 18: 36,763,124 G289D probably damaging Het
Zfp523 C T 17: 28,202,220 T235M probably damaging Het
Other mutations in Fgfrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Fgfrl1 APN 5 108705887 missense probably damaging 1.00
IGL00756:Fgfrl1 APN 5 108705953 missense possibly damaging 0.91
IGL02641:Fgfrl1 APN 5 108705865 missense probably damaging 1.00
R0725:Fgfrl1 UTSW 5 108704673 missense probably damaging 0.99
R1398:Fgfrl1 UTSW 5 108706281 unclassified probably benign
R1967:Fgfrl1 UTSW 5 108705005 missense probably damaging 1.00
R2403:Fgfrl1 UTSW 5 108705031 missense probably damaging 1.00
R3032:Fgfrl1 UTSW 5 108706060 missense probably benign 0.13
R3605:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3606:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3607:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3767:Fgfrl1 UTSW 5 108705376 missense possibly damaging 0.78
R4603:Fgfrl1 UTSW 5 108703535 missense probably damaging 1.00
R4798:Fgfrl1 UTSW 5 108703497 nonsense probably null
R5600:Fgfrl1 UTSW 5 108705302 missense probably damaging 1.00
R6349:Fgfrl1 UTSW 5 108705506 missense probably damaging 1.00
R6679:Fgfrl1 UTSW 5 108704973 missense probably damaging 1.00
R7247:Fgfrl1 UTSW 5 108703499 missense possibly damaging 0.91
X0018:Fgfrl1 UTSW 5 108704974 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCCTGGCATCTTTACATAGC -3'
(R):5'- AACATGTCAGCACAGTTTTAGGC -3'

Sequencing Primer
(F):5'- ACATAGCCTTTCTACTGACCTCGATG -3'
(R):5'- ACAGTTTTAGGCACCACGG -3'
Posted On2018-07-23