Incidental Mutation 'R6588:Macroh2a1'
ID 527427
Institutional Source Beutler Lab
Gene Symbol Macroh2a1
Ensembl Gene ENSMUSG00000015937
Gene Name macroH2A.1 histone
Synonyms mH2a1, MACROH2A1.2, H2AF12M, H2afy
MMRRC Submission 044712-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6588 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 56221435-56283439 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 56252302 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 97 (G97D)
Ref Sequence ENSEMBL: ENSMUSP00000038221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016081] [ENSMUST00000045788]
AlphaFold Q9QZQ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000016081
AA Change: G97D

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016081
Gene: ENSMUSG00000015937
AA Change: G97D

DomainStartEndE-ValueType
H2A 1 120 3.52e-72 SMART
low complexity region 130 163 N/A INTRINSIC
A1pp 196 330 2.72e-28 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000045788
AA Change: G97D

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038221
Gene: ENSMUSG00000015937
AA Change: G97D

DomainStartEndE-ValueType
H2A 1 120 3.52e-72 SMART
low complexity region 130 163 N/A INTRINSIC
A1pp 196 327 4.88e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154778
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and participates in stable X chromosome inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for one knock-out allele are viable and fertile and display no gross phenotypic abnormalities. Mice homozygous for a different knock-out allele exhibit female-specific hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,340,766 (GRCm39) S132P probably benign Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Homo
Clcn3 T C 8: 61,367,861 (GRCm39) I763V probably benign Het
Cpsf1 A G 15: 76,481,022 (GRCm39) Y1254H probably damaging Het
Erc1 C T 6: 119,552,687 (GRCm39) A1088T possibly damaging Het
Fhl4 A G 10: 84,933,971 (GRCm39) V270A possibly damaging Het
Ghr T C 15: 3,349,750 (GRCm39) E476G probably benign Het
Ighv1-84 T A 12: 115,944,371 (GRCm39) Q101L probably benign Het
Itfg1 T C 8: 86,462,759 (GRCm39) I455V probably benign Het
Kitl T A 10: 99,899,954 (GRCm39) N86K probably damaging Het
Kmt2c C T 5: 25,528,787 (GRCm39) G1614E probably damaging Het
Lrrd1 A G 5: 3,901,386 (GRCm39) S564G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,496,617 (GRCm39) probably null Het
Mms19 C T 19: 41,954,715 (GRCm39) R68Q probably damaging Het
Or10aa1 G T 1: 173,869,844 (GRCm39) M109I probably benign Het
Or1o1 G A 17: 37,716,796 (GRCm39) R119H probably benign Het
Or7e173 G T 9: 19,939,162 (GRCm39) P24Q probably damaging Het
Urb2 G T 8: 124,757,864 (GRCm39) E1190D probably damaging Het
Zfp64 A T 2: 168,768,827 (GRCm39) C262S probably damaging Het
Other mutations in Macroh2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Macroh2a1 APN 13 56,222,132 (GRCm39) missense possibly damaging 0.75
IGL01294:Macroh2a1 APN 13 56,222,113 (GRCm39) missense probably damaging 1.00
IGL02505:Macroh2a1 APN 13 56,222,143 (GRCm39) missense probably damaging 1.00
IGL02994:Macroh2a1 APN 13 56,252,112 (GRCm39) splice site probably benign
R0270:Macroh2a1 UTSW 13 56,243,927 (GRCm39) splice site probably benign
R0988:Macroh2a1 UTSW 13 56,231,109 (GRCm39) critical splice acceptor site probably null
R1464:Macroh2a1 UTSW 13 56,230,949 (GRCm39) missense probably damaging 0.98
R1464:Macroh2a1 UTSW 13 56,230,949 (GRCm39) missense probably damaging 0.98
R1638:Macroh2a1 UTSW 13 56,252,722 (GRCm39) missense probably damaging 1.00
R1782:Macroh2a1 UTSW 13 56,222,134 (GRCm39) missense probably damaging 0.99
R1850:Macroh2a1 UTSW 13 56,244,052 (GRCm39) splice site probably benign
R1860:Macroh2a1 UTSW 13 56,231,017 (GRCm39) missense probably damaging 1.00
R2228:Macroh2a1 UTSW 13 56,232,075 (GRCm39) missense probably damaging 1.00
R4674:Macroh2a1 UTSW 13 56,230,997 (GRCm39) missense possibly damaging 0.91
R5102:Macroh2a1 UTSW 13 56,243,936 (GRCm39) critical splice donor site probably null
R5106:Macroh2a1 UTSW 13 56,236,106 (GRCm39) missense possibly damaging 0.75
R5161:Macroh2a1 UTSW 13 56,237,594 (GRCm39) missense probably benign 0.05
R5862:Macroh2a1 UTSW 13 56,222,084 (GRCm39) missense probably damaging 1.00
R6165:Macroh2a1 UTSW 13 56,252,268 (GRCm39) missense probably damaging 0.97
R6994:Macroh2a1 UTSW 13 56,237,643 (GRCm39) missense probably benign 0.11
R7669:Macroh2a1 UTSW 13 56,276,146 (GRCm39) missense probably damaging 1.00
R9152:Macroh2a1 UTSW 13 56,232,004 (GRCm39) frame shift probably null
R9732:Macroh2a1 UTSW 13 56,243,976 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ATATCCCTGCCAGATCCCGTAC -3'
(R):5'- ACTCGAGTCCCATGTGGTAG -3'

Sequencing Primer
(F):5'- TGCCAGATCCCGTACCTTAGAC -3'
(R):5'- GGTAGGTCTGAGTCCTGCC -3'
Posted On 2018-07-23