Mutagenetix > Incidental Mutation

Incidental Mutation 'R6740:Rnf180'

527439

Institutional Source

Beutler Lab

Gene Symbol

Rnf180

Ensembl Gene

ENSMUSG00000021720

Gene Name

ring finger protein 180

Synonyms

3110001E11Rik, Rines

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R6740 (G1) of strain 613

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

105267075-105431406 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105318014 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 466 (A466V)

Ref Sequence

ENSEMBL: ENSMUSP00000153506 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069686] [ENSMUST00000224011] [ENSMUST00000224662] [ENSMUST00000226044]

AlphaFold

Q3U827

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069686
AA Change: A466V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064624
Gene: ENSMUSG00000021720
AA Change: A466V

Domain	Start	End	E-Value	Type
low complexity region	4	19	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC
low complexity region	378	395	N/A	INTRINSIC
RING	432	473	1.65e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224011
AA Change: A466V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000224662
AA Change: A466V

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226044
AA Change: A465V

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Knock-out mice show impaired stress responses, enhanced anxiety, and affiliative behavior. Norepinephrine and serotonin levels are decreased in the locus ceruleus, prefrontal cortex, and amygdala and MAO-A enzyme activity is enhanced in the locus ceruleus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 8 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cyp2e1	C	T	7: 140,343,693 (GRCm39)		probably benign	Het
Eea1	C	G	10: 95,859,855 (GRCm39)	H714D	probably benign	Het
Efcab8	A	G	2: 153,646,814 (GRCm39)	H381R	probably damaging	Het
Fer1l4	A	G	2: 155,873,142 (GRCm39)	S1313P	probably damaging	Het
Itih3	T	C	14: 30,634,644 (GRCm39)	N121S	probably benign	Het
Lgr6	C	T	1: 134,921,748 (GRCm39)	A199T	probably damaging	Het
Lrch1	A	G	14: 75,049,063 (GRCm39)	S395P	probably benign	Het
Zfp1006	A	C	8: 129,960,881 (GRCm39)		probably null	Het

Other mutations in Rnf180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01520:Rnf180	APN	13	105,386,864 (GRCm39)	missense	probably damaging	0.96
R0270:Rnf180	UTSW	13	105,388,774 (GRCm39)	missense	probably benign	0.06
R1660:Rnf180	UTSW	13	105,407,499 (GRCm39)	missense	probably benign	0.04
R3881:Rnf180	UTSW	13	105,386,915 (GRCm39)	missense	possibly damaging	0.62
R6007:Rnf180	UTSW	13	105,317,957 (GRCm39)	critical splice donor site	probably null
R6824:Rnf180	UTSW	13	105,318,023 (GRCm39)	missense	probably damaging	1.00
R7021:Rnf180	UTSW	13	105,407,429 (GRCm39)	missense	probably benign	0.03
R7655:Rnf180	UTSW	13	105,304,096 (GRCm39)	missense	probably damaging	1.00
R7656:Rnf180	UTSW	13	105,304,096 (GRCm39)	missense	probably damaging	1.00
R8352:Rnf180	UTSW	13	105,318,056 (GRCm39)	missense	probably damaging	1.00
R8452:Rnf180	UTSW	13	105,318,056 (GRCm39)	missense	probably damaging	1.00
R9288:Rnf180	UTSW	13	105,386,781 (GRCm39)	small insertion	probably benign
R9396:Rnf180	UTSW	13	105,318,027 (GRCm39)	nonsense	probably null
R9409:Rnf180	UTSW	13	105,386,781 (GRCm39)	small insertion	probably benign
R9410:Rnf180	UTSW	13	105,386,781 (GRCm39)	small insertion	probably benign
R9636:Rnf180	UTSW	13	105,386,819 (GRCm39)	missense	possibly damaging	0.52
Z1177:Rnf180	UTSW	13	105,318,121 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGTGGTTCTGGGATAGCAC -3'
(R):5'- TGTTGCAGACCGTGAGTAATG -3'

Sequencing Primer
(F):5'- GCTTTATACACTAGAGCAGAAGTCAC -3'
(R):5'- TTGCAGACCGTGAGTAATGAGATG -3'

Posted On

2018-07-23