Incidental Mutation 'R6682:Zfp704'
ID527527
Institutional Source Beutler Lab
Gene Symbol Zfp704
Ensembl Gene ENSMUSG00000040209
Gene Namezinc finger protein 704
SynonymsGig1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6682 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location9427020-9610085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9565193 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 36 (E36G)
Ref Sequence ENSEMBL: ENSMUSP00000141598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041124] [ENSMUST00000193947]
Predicted Effect probably benign
Transcript: ENSMUST00000041124
AA Change: E186G

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041242
Gene: ENSMUSG00000040209
AA Change: E186G

DomainStartEndE-ValueType
low complexity region 12 94 N/A INTRINSIC
low complexity region 98 129 N/A INTRINSIC
low complexity region 267 290 N/A INTRINSIC
ZnF_C2H2 346 371 3.58e-2 SMART
c-clamp 536 566 1.55e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193947
AA Change: E36G

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141598
Gene: ENSMUSG00000040209
AA Change: E36G

DomainStartEndE-ValueType
low complexity region 117 140 N/A INTRINSIC
ZnF_C2H2 196 221 1.6e-4 SMART
c-clamp 475 505 7.4e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter (null) allele are viable and fertile with no obvious developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Zfp704
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Zfp704 APN 3 9565239 missense possibly damaging 0.61
IGL03288:Zfp704 APN 3 9439891 splice site probably benign
R0265:Zfp704 UTSW 3 9565157 missense probably damaging 1.00
R0524:Zfp704 UTSW 3 9609364 missense unknown
R1466:Zfp704 UTSW 3 9447348 missense possibly damaging 0.94
R1466:Zfp704 UTSW 3 9447348 missense possibly damaging 0.94
R1647:Zfp704 UTSW 3 9471039 missense probably damaging 1.00
R1648:Zfp704 UTSW 3 9471039 missense probably damaging 1.00
R1865:Zfp704 UTSW 3 9474491 splice site probably benign
R1912:Zfp704 UTSW 3 9609358 missense unknown
R2109:Zfp704 UTSW 3 9474525 missense probably damaging 1.00
R2566:Zfp704 UTSW 3 9609493 missense unknown
R3551:Zfp704 UTSW 3 9474525 missense probably damaging 1.00
R4495:Zfp704 UTSW 3 9471077 missense probably benign 0.01
R6165:Zfp704 UTSW 3 9443886 missense probably benign 0.00
R7057:Zfp704 UTSW 3 9470917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGACAGACAGCTCTTGC -3'
(R):5'- GAGTAGTCTCTCTTCACCACAGC -3'

Sequencing Primer
(F):5'- CTTGCTAAGTCTAGACCCTGTGAAAC -3'
(R):5'- TCTTCACCACAGCCCTGCAG -3'
Posted On2018-07-23