Incidental Mutation 'R6682:Grik3'
ID527531
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Nameglutamate receptor, ionotropic, kainate 3
SynonymsGlur7, Glur-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R6682 (G1)
Quality Score122.008
Status Not validated
Chromosome4
Chromosomal Location125490700-125714173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125650466 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 327 (Y327N)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
Predicted Effect probably damaging
Transcript: ENSMUST00000030676
AA Change: Y327N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: Y327N

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r79 C A 7: 87,004,162 T545K possibly damaging Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125632415 missense probably benign
IGL01534:Grik3 APN 4 125686190 missense probably damaging 1.00
IGL01538:Grik3 APN 4 125694036 missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125623502 missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125685990 splice site probably benign
IGL02475:Grik3 APN 4 125650517 missense probably benign
IGL03198:Grik3 APN 4 125659762 missense probably benign 0.25
IGL03307:Grik3 APN 4 125641554 missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0116:Grik3 UTSW 4 125670556 missense probably benign 0.01
R0208:Grik3 UTSW 4 125686165 missense probably damaging 1.00
R0497:Grik3 UTSW 4 125623510 missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125704564 splice site probably benign
R1296:Grik3 UTSW 4 125704564 splice site probably benign
R1515:Grik3 UTSW 4 125670728 missense probably benign 0.37
R1559:Grik3 UTSW 4 125707997 missense probably benign 0.16
R1617:Grik3 UTSW 4 125691192 missense probably benign
R1848:Grik3 UTSW 4 125694138 missense probably damaging 1.00
R2903:Grik3 UTSW 4 125670644 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3842:Grik3 UTSW 4 125693954 splice site probably benign
R4649:Grik3 UTSW 4 125650485 missense probably damaging 1.00
R4841:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R4842:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R5093:Grik3 UTSW 4 125670589 missense probably benign
R5318:Grik3 UTSW 4 125694136 missense probably damaging 0.96
R5549:Grik3 UTSW 4 125686045 missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125705123 missense probably damaging 0.99
R6226:Grik3 UTSW 4 125659789 missense probably benign 0.04
R6306:Grik3 UTSW 4 125632412 missense probably benign 0.01
R6672:Grik3 UTSW 4 125623516 missense probably benign 0.08
R6783:Grik3 UTSW 4 125632300 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTATCCATAGACTAACAGGGCC -3'
(R):5'- TTCTGAGCCCCAAACCTGAG -3'

Sequencing Primer
(F):5'- CACTGAGGCTGGTCTGTCTTCAG -3'
(R):5'- TCTATGACTGAGCACTGGAGGC -3'
Posted On2018-07-23