Incidental Mutation 'R6682:Vmn2r79'
ID527542
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Namevomeronasal 2, receptor 79
SynonymsEG621430
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6682 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86996465-87037968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87004162 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 545 (T545K)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164462
AA Change: T545K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: T545K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm T C 1: 139,457,722 V368A possibly damaging Het
Bcl9l A G 9: 44,501,103 T92A possibly damaging Het
Celsr2 A T 3: 108,400,501 probably null Het
Cndp2 T C 18: 84,677,330 K149E probably benign Het
Cnpy4 T C 5: 138,187,722 probably null Het
Cox6c A T 15: 35,938,173 probably null Het
Cpt2 G T 4: 107,904,430 S158R probably damaging Het
Dlgap1 A G 17: 70,787,123 K813R probably damaging Het
Dock10 A C 1: 80,512,621 L1927R probably damaging Het
Gak T A 5: 108,598,876 K430I probably damaging Het
Grik3 T A 4: 125,650,466 Y327N probably damaging Het
Ldb3 T A 14: 34,552,264 T334S possibly damaging Het
Ldlr A G 9: 21,732,375 D85G probably benign Het
Med26 T A 8: 72,496,083 T391S probably benign Het
Mmp27 A G 9: 7,573,605 T233A probably benign Het
Mob1a A G 6: 83,334,150 Y117C possibly damaging Het
Mrps35 A T 6: 147,048,279 E97V possibly damaging Het
Msln A T 17: 25,753,019 S75T probably damaging Het
Myoz1 C T 14: 20,653,619 probably null Het
Nim1k A G 13: 119,712,188 I390T probably benign Het
Olfr1301 C T 2: 111,754,635 P129S probably damaging Het
Olfr370 A G 8: 83,541,558 H138R probably benign Het
Pclo A C 5: 14,539,879 Q731P unknown Het
Prl3d3 G A 13: 27,161,040 E132K probably benign Het
Pth1r C T 9: 110,727,251 probably null Het
Ptpru T C 4: 131,820,782 M135V probably benign Het
Slc12a9 A T 5: 137,327,401 L316Q probably damaging Het
Slc35f6 G A 5: 30,657,420 M177I possibly damaging Het
Smc4 T A 3: 69,007,241 S62R probably damaging Het
Tmem179 C T 12: 112,503,280 D29N probably benign Het
Togaram2 A T 17: 71,704,754 D476V probably benign Het
Trpc4ap C T 2: 155,637,767 probably null Het
Trpm8 C A 1: 88,326,502 T149K probably damaging Het
Uhmk1 C T 1: 170,212,235 probably null Het
Vmn2r95 C A 17: 18,440,227 N300K probably damaging Het
Wdr41 G A 13: 95,013,131 G419D probably damaging Het
Zc3hav1 A T 6: 38,325,195 H597Q probably benign Het
Zfp704 T C 3: 9,565,193 E36G probably benign Het
Zfp9 A G 6: 118,467,241 V47A possibly damaging Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87037273 missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86996648 missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87002158 missense probably benign
IGL01834:Vmn2r79 APN 7 87037146 missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87037277 missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87037363 missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87037082 missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87002536 missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87004158 missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 87003591 missense probably benign 0.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87003386 missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87002079 missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87002403 missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87003473 missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87004099 missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87037794 missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87037444 missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87004039 critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87037834 missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87002631 missense probably benign
R1781:Vmn2r79 UTSW 7 87002347 missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87001413 missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87037872 missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87004081 missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86996631 missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87002037 missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87002194 missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87003593 missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87002416 missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 87037960 missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 87001467 missense probably benign
R5016:Vmn2r79 UTSW 7 87037340 missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87002215 missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 87001969 missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87002570 missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87037157 missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87037768 missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 87001314 missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 87002290 missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87002044 missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87003533 missense probably benign 0.01
R6858:Vmn2r79 UTSW 7 87037372 missense probably benign
R6965:Vmn2r79 UTSW 7 87001892 missense probably benign 0.10
R7130:Vmn2r79 UTSW 7 87002266 missense not run
U15987:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87004062 missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87002341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAATCACTGCAGTGTTTGAC -3'
(R):5'- GCATGCAACCATAAGAAATGTGTG -3'

Sequencing Primer
(F):5'- TCCGCATGTAGTGTACCT -3'
(R):5'- CATTAGTGTGAATATGGGAGA -3'
Posted On2018-07-23