Incidental Mutation 'R6685:Slc9a2'
ID527635
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms2210416H12Rik, 4932415O19Rik, NHE2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6685 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location40680574-40769273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40718909 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 203 (I203F)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
Predicted Effect probably damaging
Transcript: ENSMUST00000027231
AA Change: I203F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: I203F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192345
AA Change: I203F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: I203F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 G T 11: 116,180,348 Y203* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Adgrb3 G A 1: 25,111,736 Q1139* probably null Het
Casc3 A G 11: 98,822,530 K257E probably damaging Het
Cttnbp2nl G T 3: 105,005,498 Q357K probably benign Het
Dcst1 A C 3: 89,356,873 V345G possibly damaging Het
Dsg3 G A 18: 20,520,615 probably null Het
Ehbp1 A G 11: 22,146,641 C308R probably benign Het
Etaa1 G T 11: 17,953,582 D71E probably benign Het
Flg T C 3: 93,279,409 V56A possibly damaging Het
Gpr162 A G 6: 124,861,531 L52P probably damaging Het
Inhbb A G 1: 119,417,605 L318P probably damaging Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Mcm8 G A 2: 132,842,650 R728Q probably damaging Het
Metap1 A T 3: 138,478,834 F126I possibly damaging Het
Olfr575 T C 7: 102,955,681 probably null Het
Peg10 T A 6: 4,754,738 V173E probably damaging Het
Poteg T A 8: 27,447,905 F30I possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Sh3rf3 C T 10: 59,086,841 L580F possibly damaging Het
Slc26a7 C A 4: 14,593,819 V99F probably damaging Het
Slc26a7 A T 4: 14,593,820 H98Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Txnrd3 G A 6: 89,669,915 V347I possibly damaging Het
Wisp2 A G 2: 163,828,948 D125G possibly damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40767737 missense probably benign
IGL00487:Slc9a2 APN 1 40742658 missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40763583 missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40718810 missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40756293 missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40742669 missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40763602 missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40742703 missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40756271 missense probably benign 0.00
E0370:Slc9a2 UTSW 1 40763541 critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40743841 missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40763602 missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40742804 missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40743857 missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40719018 missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40726388 missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40763610 missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40742643 missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40726437 missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40742768 missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40742608 splice site probably null
R3612:Slc9a2 UTSW 1 40719058 splice site probably null
R4631:Slc9a2 UTSW 1 40761918 missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40761916 missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40726374 missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40718849 missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40755718 missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40743893 missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40682036 missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40742653 nonsense probably null
R6453:Slc9a2 UTSW 1 40742621 missense possibly damaging 0.64
R7088:Slc9a2 UTSW 1 40726379 missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40767668 missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40681835 start gained probably benign
X0054:Slc9a2 UTSW 1 40742687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCGGCAATGAAGACAGATG -3'
(R):5'- GAGAGCCTTCTACTATGTGAGTG -3'

Sequencing Primer
(F):5'- GGCAATGAAGACAGATGTGTTTTTCC -3'
(R):5'- AGCCTTCTACTATGTGAGTGGTAAG -3'
Posted On2018-07-23