Incidental Mutation 'R6685:Mcm8'
ID527637
Institutional Source Beutler Lab
Gene Symbol Mcm8
Ensembl Gene ENSMUSG00000027353
Gene Nameminichromosome maintenance 8 homologous recombination repair factor
Synonyms5730432L01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R6685 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location132816141-132844197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132842650 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 728 (R728Q)
Ref Sequence ENSEMBL: ENSMUSP00000066842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028831] [ENSMUST00000028835] [ENSMUST00000066559] [ENSMUST00000110122] [ENSMUST00000124834]
Predicted Effect probably damaging
Transcript: ENSMUST00000028831
AA Change: R756Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028831
Gene: ENSMUSG00000027353
AA Change: R756Q

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
Blast:MCM 79 155 2e-28 BLAST
MCM 198 742 2.42e-136 SMART
AAA 439 590 5.99e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028835
SMART Domains Protein: ENSMUSP00000028835
Gene: ENSMUSG00000027357

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 71 93 N/A INTRINSIC
Pfam:CDP-OH_P_transf 107 288 1.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066559
AA Change: R728Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066842
Gene: ENSMUSG00000027353
AA Change: R728Q

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:MCM 51 127 2e-28 BLAST
MCM 170 714 2.42e-136 SMART
AAA 411 562 5.99e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110122
SMART Domains Protein: ENSMUSP00000105749
Gene: ENSMUSG00000027357

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 71 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124834
SMART Domains Protein: ENSMUSP00000129509
Gene: ENSMUSG00000027357

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 71 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135990
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the mini-chromosome maintenance proteins is a key component of the pre-replication complex and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein contains the central domain that is conserved among the mini-chromosome maintenance proteins. The encoded protein may interact with other mini-chromosome maintenance proteins and play a role in DNA replication. This gene may be associated with length of reproductive lifespan and menopause. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility associated with impaired ovarian development and arrested male meiosis, and impaired sensitivity to homologous recombination double-strand break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 G T 11: 116,180,348 Y203* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Adgrb3 G A 1: 25,111,736 Q1139* probably null Het
Casc3 A G 11: 98,822,530 K257E probably damaging Het
Cttnbp2nl G T 3: 105,005,498 Q357K probably benign Het
Dcst1 A C 3: 89,356,873 V345G possibly damaging Het
Dsg3 G A 18: 20,520,615 probably null Het
Ehbp1 A G 11: 22,146,641 C308R probably benign Het
Etaa1 G T 11: 17,953,582 D71E probably benign Het
Flg T C 3: 93,279,409 V56A possibly damaging Het
Gpr162 A G 6: 124,861,531 L52P probably damaging Het
Inhbb A G 1: 119,417,605 L318P probably damaging Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Metap1 A T 3: 138,478,834 F126I possibly damaging Het
Olfr575 T C 7: 102,955,681 probably null Het
Peg10 T A 6: 4,754,738 V173E probably damaging Het
Poteg T A 8: 27,447,905 F30I possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Sh3rf3 C T 10: 59,086,841 L580F possibly damaging Het
Slc26a7 C A 4: 14,593,819 V99F probably damaging Het
Slc26a7 A T 4: 14,593,820 H98Q probably damaging Het
Slc9a2 A T 1: 40,718,909 I203F probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Txnrd3 G A 6: 89,669,915 V347I possibly damaging Het
Wisp2 A G 2: 163,828,948 D125G possibly damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Other mutations in Mcm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Mcm8 APN 2 132827537 missense probably benign
IGL00479:Mcm8 APN 2 132817174 missense probably benign
IGL00573:Mcm8 APN 2 132832812 missense possibly damaging 0.94
IGL00847:Mcm8 APN 2 132819674 missense probably benign 0.29
IGL00978:Mcm8 APN 2 132821406 missense probably benign
IGL01390:Mcm8 APN 2 132838078 splice site probably benign
IGL01785:Mcm8 APN 2 132827948 missense probably benign 0.05
IGL01786:Mcm8 APN 2 132827948 missense probably benign 0.05
IGL02216:Mcm8 APN 2 132839529 missense probably damaging 1.00
IGL03191:Mcm8 APN 2 132821442 missense possibly damaging 0.68
madamina UTSW 2 132832854 missense probably damaging 1.00
PIT4687001:Mcm8 UTSW 2 132817177 missense possibly damaging 0.54
R0329:Mcm8 UTSW 2 132819994 missense possibly damaging 0.64
R0330:Mcm8 UTSW 2 132819994 missense possibly damaging 0.64
R1520:Mcm8 UTSW 2 132839455 missense probably benign 0.39
R1771:Mcm8 UTSW 2 132843556 nonsense probably null
R1967:Mcm8 UTSW 2 132842742 missense probably benign
R2228:Mcm8 UTSW 2 132820121 missense possibly damaging 0.85
R2418:Mcm8 UTSW 2 132824738 missense probably benign
R4728:Mcm8 UTSW 2 132832854 missense probably damaging 1.00
R4827:Mcm8 UTSW 2 132823254 missense probably damaging 0.99
R4847:Mcm8 UTSW 2 132820003 missense probably benign 0.01
R4928:Mcm8 UTSW 2 132839479 missense probably benign 0.00
R4932:Mcm8 UTSW 2 132838709 missense probably benign 0.09
R4962:Mcm8 UTSW 2 132838769 missense probably damaging 1.00
R6044:Mcm8 UTSW 2 132831680 critical splice donor site probably null
R6081:Mcm8 UTSW 2 132828083 missense probably benign 0.00
R6650:Mcm8 UTSW 2 132821407 missense probably benign 0.01
R7006:Mcm8 UTSW 2 132823261 missense probably damaging 1.00
R7176:Mcm8 UTSW 2 132820072 missense probably benign 0.01
R7328:Mcm8 UTSW 2 132832857 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATATCCTAATGAATTTCAAAGTGGCT -3'
(R):5'- CCAAAACCTTTGAGAAGAGGTAAC -3'

Sequencing Primer
(F):5'- TTCAAAGTGGCTAAGTCTCACAGC -3'
(R):5'- CAGCCTGGTCTAAAGTTTCAGGAC -3'
Posted On2018-07-23