Incidental Mutation 'R6685:Lkaaear1'
ID527639
Institutional Source Beutler Lab
Gene Symbol Lkaaear1
Ensembl Gene ENSMUSG00000045794
Gene NameLKAAEAR motif containing 1 (IKAAEAR murine motif)
SynonymsLOC277496, 4930526D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6685 (G1)
Quality Score174.468
Status Not validated
Chromosome2
Chromosomal Location181696793-181698442 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG to TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG at 181697561 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002532] [ENSMUST00000052416] [ENSMUST00000108769] [ENSMUST00000108771] [ENSMUST00000108772] [ENSMUST00000108776] [ENSMUST00000108779]
Predicted Effect probably benign
Transcript: ENSMUST00000002532
SMART Domains Protein: ENSMUSP00000002532
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052416
SMART Domains Protein: ENSMUSP00000061134
Gene: ENSMUSG00000045794

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:LKAAEAR 44 179 1.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108769
SMART Domains Protein: ENSMUSP00000104400
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Pfam:RGS 90 160 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108771
SMART Domains Protein: ENSMUSP00000104402
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108772
SMART Domains Protein: ENSMUSP00000104403
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108776
SMART Domains Protein: ENSMUSP00000104406
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108779
SMART Domains Protein: ENSMUSP00000104409
Gene: ENSMUSG00000002458

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130712
Predicted Effect probably benign
Transcript: ENSMUST00000132409
SMART Domains Protein: ENSMUSP00000116083
Gene: ENSMUSG00000045794

DomainStartEndE-ValueType
Pfam:LKAAEAR 1 91 7.2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143510
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 G T 11: 116,180,348 Y203* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Adgrb3 G A 1: 25,111,736 Q1139* probably null Het
Casc3 A G 11: 98,822,530 K257E probably damaging Het
Cttnbp2nl G T 3: 105,005,498 Q357K probably benign Het
Dcst1 A C 3: 89,356,873 V345G possibly damaging Het
Dsg3 G A 18: 20,520,615 probably null Het
Ehbp1 A G 11: 22,146,641 C308R probably benign Het
Etaa1 G T 11: 17,953,582 D71E probably benign Het
Flg T C 3: 93,279,409 V56A possibly damaging Het
Gpr162 A G 6: 124,861,531 L52P probably damaging Het
Inhbb A G 1: 119,417,605 L318P probably damaging Het
Mcm8 G A 2: 132,842,650 R728Q probably damaging Het
Metap1 A T 3: 138,478,834 F126I possibly damaging Het
Olfr575 T C 7: 102,955,681 probably null Het
Peg10 T A 6: 4,754,738 V173E probably damaging Het
Poteg T A 8: 27,447,905 F30I possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Sh3rf3 C T 10: 59,086,841 L580F possibly damaging Het
Slc26a7 C A 4: 14,593,819 V99F probably damaging Het
Slc26a7 A T 4: 14,593,820 H98Q probably damaging Het
Slc9a2 A T 1: 40,718,909 I203F probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Txnrd3 G A 6: 89,669,915 V347I possibly damaging Het
Wisp2 A G 2: 163,828,948 D125G possibly damaging Het
Zfp42 G A 8: 43,296,056 T136M possibly damaging Het
Other mutations in Lkaaear1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Lkaaear1 APN 2 181697334 missense probably benign 0.00
IGL01508:Lkaaear1 APN 2 181697037 missense probably benign 0.09
FR4304:Lkaaear1 UTSW 2 181697579 unclassified probably benign
FR4340:Lkaaear1 UTSW 2 181697594 unclassified probably benign
FR4449:Lkaaear1 UTSW 2 181697571 unclassified probably benign
R3430:Lkaaear1 UTSW 2 181697531 missense probably benign 0.02
R4994:Lkaaear1 UTSW 2 181697583 nonsense probably null
R6683:Lkaaear1 UTSW 2 181697561 unclassified probably benign
R6684:Lkaaear1 UTSW 2 181697561 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTCGTAGGGTAACTCCACC -3'
(R):5'- GATATGCACAGGGTCAGCTAC -3'

Sequencing Primer
(F):5'- TAGGGTAACTCCACCGACTCG -3'
(R):5'- TTAGGTGGCTACAGGAAGTCCC -3'
Posted On2018-07-23