Incidental Mutation 'R6685:Txnrd3'
ID 527647
Institutional Source Beutler Lab
Gene Symbol Txnrd3
Ensembl Gene ENSMUSG00000000811
Gene Name thioredoxin reductase 3
Synonyms TR2, Tgr
MMRRC Submission 044804-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.671) question?
Stock # R6685 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 89620970-89652511 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89646897 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 347 (V347I)
Ref Sequence ENSEMBL: ENSMUSP00000098730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000828] [ENSMUST00000101171]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000828
AA Change: V461I

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000000828
Gene: ENSMUSG00000000811
AA Change: V461I

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
Pfam:Glutaredoxin 40 102 9.2e-18 PFAM
Pfam:Pyr_redox_2 129 466 2.5e-66 PFAM
Pfam:FAD_binding_2 130 290 4.6e-9 PFAM
Pfam:Pyr_redox 309 386 9.6e-16 PFAM
Pfam:Pyr_redox_dim 486 599 2.7e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101171
AA Change: V347I

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098730
Gene: ENSMUSG00000000811
AA Change: V347I

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
Pfam:Glutaredoxin 40 102 1.5e-18 PFAM
Pfam:Thi4 116 222 3.9e-7 PFAM
Pfam:FAD_binding_2 130 264 3.7e-9 PFAM
Pfam:Pyr_redox_2 130 342 2.9e-24 PFAM
Pfam:Pyr_redox_dim 372 485 2.8e-31 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the family of pyridine nucleotide oxidoreductases. This protein catalyzes the reduction of thioredoxin, but unlike other mammalian thioredoxin reductases (TRs), it contains an additional glutaredoxin domain, and shows highest expression in testes. Like other TRs, it contains a C-terminal, penultimate selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for the use of a non-AUG (CUG) translation initiation site upstream of, and in-frame with the first AUG, leading to additional isoforms. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 G T 11: 116,071,174 (GRCm39) Y203* probably null Het
Adcy5 A G 16: 35,099,586 (GRCm39) N712S possibly damaging Het
Adgrb3 G A 1: 25,150,817 (GRCm39) Q1139* probably null Het
Casc3 A G 11: 98,713,356 (GRCm39) K257E probably damaging Het
Ccn5 A G 2: 163,670,868 (GRCm39) D125G possibly damaging Het
Cttnbp2nl G T 3: 104,912,814 (GRCm39) Q357K probably benign Het
Dcst1 A C 3: 89,264,180 (GRCm39) V345G possibly damaging Het
Dsg3 G A 18: 20,653,672 (GRCm39) probably null Het
Ehbp1 A G 11: 22,096,641 (GRCm39) C308R probably benign Het
Etaa1 G T 11: 17,903,582 (GRCm39) D71E probably benign Het
Flg T C 3: 93,186,716 (GRCm39) V56A possibly damaging Het
Gpr162 A G 6: 124,838,494 (GRCm39) L52P probably damaging Het
Inhbb A G 1: 119,345,335 (GRCm39) L318P probably damaging Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,339,354 (GRCm39) probably benign Het
Mcm8 G A 2: 132,684,570 (GRCm39) R728Q probably damaging Het
Metap1 A T 3: 138,184,595 (GRCm39) F126I possibly damaging Het
Or51a6 T C 7: 102,604,888 (GRCm39) probably null Het
Peg10 T A 6: 4,754,738 (GRCm39) V173E probably damaging Het
Poteg T A 8: 27,937,933 (GRCm39) F30I possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Homo
Sh3rf3 C T 10: 58,922,663 (GRCm39) L580F possibly damaging Het
Slc26a7 C A 4: 14,593,819 (GRCm39) V99F probably damaging Het
Slc26a7 A T 4: 14,593,820 (GRCm39) H98Q probably damaging Het
Slc9a2 A T 1: 40,758,069 (GRCm39) I203F probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Zfp42 G A 8: 43,749,093 (GRCm39) T136M possibly damaging Het
Other mutations in Txnrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Txnrd3 APN 6 89,631,129 (GRCm39) missense probably benign 0.15
IGL01763:Txnrd3 APN 6 89,638,537 (GRCm39) missense probably damaging 0.97
IGL02159:Txnrd3 APN 6 89,646,306 (GRCm39) missense probably damaging 1.00
IGL02238:Txnrd3 APN 6 89,633,117 (GRCm39) missense probably benign 0.02
IGL02452:Txnrd3 APN 6 89,651,777 (GRCm39) makesense probably null
R1054:Txnrd3 UTSW 6 89,627,543 (GRCm39) nonsense probably null
R3522:Txnrd3 UTSW 6 89,640,057 (GRCm39) critical splice acceptor site probably null
R5108:Txnrd3 UTSW 6 89,650,016 (GRCm39) missense probably benign 0.33
R5653:Txnrd3 UTSW 6 89,631,067 (GRCm39) missense probably benign 0.25
R6159:Txnrd3 UTSW 6 89,640,176 (GRCm39) critical splice donor site probably null
R6246:Txnrd3 UTSW 6 89,628,523 (GRCm39) missense probably benign 0.01
R6519:Txnrd3 UTSW 6 89,631,405 (GRCm39) critical splice donor site probably null
R6661:Txnrd3 UTSW 6 89,631,134 (GRCm39) nonsense probably null
R7353:Txnrd3 UTSW 6 89,638,567 (GRCm39) missense probably benign 0.02
R8987:Txnrd3 UTSW 6 89,638,477 (GRCm39) missense possibly damaging 0.78
R9014:Txnrd3 UTSW 6 89,631,091 (GRCm39) missense probably damaging 1.00
R9479:Txnrd3 UTSW 6 89,640,084 (GRCm39) missense possibly damaging 0.48
R9506:Txnrd3 UTSW 6 89,638,461 (GRCm39) missense possibly damaging 0.81
R9528:Txnrd3 UTSW 6 89,649,954 (GRCm39) missense probably damaging 0.99
R9574:Txnrd3 UTSW 6 89,640,166 (GRCm39) nonsense probably null
R9727:Txnrd3 UTSW 6 89,651,751 (GRCm39) missense probably benign 0.02
R9802:Txnrd3 UTSW 6 89,640,176 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGGTCACTGAACACCGCAG -3'
(R):5'- TCCATGAGACCCAGACTTCAG -3'

Sequencing Primer
(F):5'- AGTCCCCAGCTGTGGTG -3'
(R):5'- GTATGCACATATTCACACAGAAAGG -3'
Posted On 2018-07-23