Incidental Mutation 'R6685:Zfp42'
ID527652
Institutional Source Beutler Lab
Gene Symbol Zfp42
Ensembl Gene ENSMUSG00000051176
Gene Namezinc finger protein 42
SynonymsZfp-42, Rex-1, Rex1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6685 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location43295063-43306980 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43296056 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 136 (T136M)
Ref Sequence ENSEMBL: ENSMUSP00000147606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082120] [ENSMUST00000209356] [ENSMUST00000211248]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082120
AA Change: T136M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080765
Gene: ENSMUSG00000051176
AA Change: T136M

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
ZnF_C2H2 170 194 6.88e-4 SMART
ZnF_C2H2 199 221 2.2e-2 SMART
ZnF_C2H2 227 251 3.95e-4 SMART
ZnF_C2H2 257 281 1.67e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209356
AA Change: T136M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211248
AA Change: T136M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele exhibit premature age-related male germ cell loss, abnormal sperm morphology, and mild testicular atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 G T 11: 116,180,348 Y203* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Adgrb3 G A 1: 25,111,736 Q1139* probably null Het
Casc3 A G 11: 98,822,530 K257E probably damaging Het
Cttnbp2nl G T 3: 105,005,498 Q357K probably benign Het
Dcst1 A C 3: 89,356,873 V345G possibly damaging Het
Dsg3 G A 18: 20,520,615 probably null Het
Ehbp1 A G 11: 22,146,641 C308R probably benign Het
Etaa1 G T 11: 17,953,582 D71E probably benign Het
Flg T C 3: 93,279,409 V56A possibly damaging Het
Gpr162 A G 6: 124,861,531 L52P probably damaging Het
Inhbb A G 1: 119,417,605 L318P probably damaging Het
Lkaaear1 TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG 2: 181,697,561 probably benign Het
Mcm8 G A 2: 132,842,650 R728Q probably damaging Het
Metap1 A T 3: 138,478,834 F126I possibly damaging Het
Olfr575 T C 7: 102,955,681 probably null Het
Peg10 T A 6: 4,754,738 V173E probably damaging Het
Poteg T A 8: 27,447,905 F30I possibly damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Sh3rf3 C T 10: 59,086,841 L580F possibly damaging Het
Slc26a7 C A 4: 14,593,819 V99F probably damaging Het
Slc26a7 A T 4: 14,593,820 H98Q probably damaging Het
Slc9a2 A T 1: 40,718,909 I203F probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Txnrd3 G A 6: 89,669,915 V347I possibly damaging Het
Wisp2 A G 2: 163,828,948 D125G possibly damaging Het
Other mutations in Zfp42
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0325:Zfp42 UTSW 8 43295951 missense probably damaging 0.98
R0648:Zfp42 UTSW 8 43295978 missense probably benign
R1494:Zfp42 UTSW 8 43295601 missense possibly damaging 0.96
R3618:Zfp42 UTSW 8 43295901 missense possibly damaging 0.94
R4695:Zfp42 UTSW 8 43296131 missense probably damaging 0.99
R4877:Zfp42 UTSW 8 43295688 missense possibly damaging 0.94
R6683:Zfp42 UTSW 8 43296056 missense possibly damaging 0.88
R6684:Zfp42 UTSW 8 43296056 missense possibly damaging 0.88
R7264:Zfp42 UTSW 8 43296275 missense probably damaging 0.96
Z1088:Zfp42 UTSW 8 43295805 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTTTCGAGCTCTCCGTGAAG -3'
(R):5'- AGGTGAGTTTTCCGAACCCATTC -3'

Sequencing Primer
(F):5'- AGCTCTCCGTGAAGGCTTTG -3'
(R):5'- TTTCCGAACCCATTCTGGAAGAGG -3'
Posted On2018-07-23