Incidental Mutation 'R6649:Raf1'
ID527677
Institutional Source Beutler Lab
Gene Symbol Raf1
Ensembl Gene ENSMUSG00000000441
Gene Namev-raf-leukemia viral oncogene 1
Synonyms6430402F14Rik, Craf1, sarcoma 3611 oncogene, c-Raf, v-Raf, Raf-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6649 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location115618067-115676635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115631341 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 236 (H236Q)
Ref Sequence ENSEMBL: ENSMUSP00000108571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000451] [ENSMUST00000112949]
Predicted Effect probably benign
Transcript: ENSMUST00000000451
AA Change: H236Q

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000000451
Gene: ENSMUSG00000000441
AA Change: H236Q

DomainStartEndE-ValueType
RBD 56 131 6.95e-35 SMART
C1 139 184 1.2e-13 SMART
low complexity region 283 301 N/A INTRINSIC
Pfam:Pkinase 349 606 7.2e-61 PFAM
Pfam:Pkinase_Tyr 349 606 3.5e-65 PFAM
Pfam:Kinase-like 400 596 3.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112949
AA Change: H236Q

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108571
Gene: ENSMUSG00000000441
AA Change: H236Q

DomainStartEndE-ValueType
RBD 56 131 6.95e-35 SMART
C1 139 184 1.2e-13 SMART
low complexity region 283 301 N/A INTRINSIC
Pfam:Pkinase_Tyr 349 606 3.4e-64 PFAM
Pfam:Pkinase 349 608 1.1e-61 PFAM
Pfam:Kinase-like 399 596 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130528
Predicted Effect unknown
Transcript: ENSMUST00000147979
AA Change: H42Q
SMART Domains Protein: ENSMUSP00000115424
Gene: ENSMUSG00000000441
AA Change: H42Q

DomainStartEndE-ValueType
Blast:RBD 2 28 9e-7 BLAST
PDB:4IHL|P 36 71 1e-9 PDB
low complexity region 110 128 N/A INTRINSIC
PDB:3OMV|B 150 205 6e-33 PDB
SCOP:d1b6cb_ 153 205 3e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204512
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are growth retarded, with hypocellular fetal livers, placental anomalies, and defects of skin and lungs, resulting in lethality around mid-gestation. Mice heterozygous for a knock-in allele exhibit hypertrophic cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Raf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Raf1 APN 6 115676569 unclassified probably benign
IGL02379:Raf1 APN 6 115644548 missense probably benign
IGL02427:Raf1 APN 6 115631327 missense probably benign
IGL02586:Raf1 APN 6 115620306 missense probably damaging 0.98
IGL02620:Raf1 APN 6 115632887 splice site probably benign
P0028:Raf1 UTSW 6 115631205 splice site probably benign
R0044:Raf1 UTSW 6 115623515 missense probably benign 0.12
R0044:Raf1 UTSW 6 115623515 missense probably benign 0.12
R0116:Raf1 UTSW 6 115626383 missense probably damaging 1.00
R0147:Raf1 UTSW 6 115632973 missense probably benign
R0148:Raf1 UTSW 6 115632973 missense probably benign
R0554:Raf1 UTSW 6 115623530 missense probably benign 0.05
R0811:Raf1 UTSW 6 115626710 critical splice donor site probably null
R0812:Raf1 UTSW 6 115626710 critical splice donor site probably null
R1070:Raf1 UTSW 6 115637699 missense probably benign 0.00
R4261:Raf1 UTSW 6 115623054 critical splice acceptor site probably null
R4669:Raf1 UTSW 6 115632919 missense probably damaging 1.00
R4846:Raf1 UTSW 6 115644583 missense possibly damaging 0.91
R5038:Raf1 UTSW 6 115620235 nonsense probably null
R5214:Raf1 UTSW 6 115637622 missense possibly damaging 0.82
R5472:Raf1 UTSW 6 115626706 splice site probably null
R5511:Raf1 UTSW 6 115620256 missense probably benign 0.32
R5539:Raf1 UTSW 6 115619356 missense probably damaging 1.00
R5926:Raf1 UTSW 6 115619898 missense probably benign 0.45
R6424:Raf1 UTSW 6 115619581 missense probably benign 0.02
R7021:Raf1 UTSW 6 115620339 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACTACTGCTGCTCATCACC -3'
(R):5'- TTTCAGAGGGATGGCAAGCAC -3'

Sequencing Primer
(F):5'- GCTGCTCATCACCACCCC -3'
(R):5'- GATGGCAAGCACATCTGTTTTTC -3'
Posted On2018-07-23