Incidental Mutation 'R6649:Hsd17b14'
ID527681
Institutional Source Beutler Lab
Gene Symbol Hsd17b14
Ensembl Gene ENSMUSG00000030825
Gene Namehydroxysteroid (17-beta) dehydrogenase 14
Synonyms0610039E24Rik, Dhrs10, retSDR3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6649 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45554893-45567752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45556076 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 11 (V11A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051810] [ENSMUST00000107752] [ENSMUST00000209517] [ENSMUST00000210300] [ENSMUST00000211155] [ENSMUST00000211797]
Predicted Effect probably benign
Transcript: ENSMUST00000051810
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107752
AA Change: V37A

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103381
Gene: ENSMUSG00000030825
AA Change: V37A

DomainStartEndE-ValueType
Pfam:KR 10 187 4.3e-12 PFAM
Pfam:adh_short 10 200 2.9e-53 PFAM
Pfam:Epimerase 12 184 4.2e-7 PFAM
Pfam:adh_short_C2 16 250 8.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209517
Predicted Effect probably damaging
Transcript: ENSMUST00000210300
AA Change: V37A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210460
Predicted Effect probably benign
Transcript: ENSMUST00000210797
Predicted Effect probably damaging
Transcript: ENSMUST00000210997
AA Change: V11A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211106
Predicted Effect probably benign
Transcript: ENSMUST00000211155
Predicted Effect probably benign
Transcript: ENSMUST00000211348
Predicted Effect probably benign
Transcript: ENSMUST00000211797
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 17-beta-hydroxysteroid dehydrogenases, such as HSD17B14, are primarily involved in metabolism of steroids at the C17 position and also of other substrates, such as fatty acids, prostaglandins, and xenobiotics (Lukacik et al., 2007 [PubMed 17067289]).[supplied by OMIM, Jun 2009]
PHENOTYPE: In a high-throughput phenotyping screen, male null mice exhibit infertility, decreased sperm production, testicular degeneration and an increased anxiety-like response to stress-induced hyperthermia. Homozygous null mice also show an increase in serum IgG2a in response to antigen challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Hsd17b14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hsd17b14 APN 7 45566713 missense possibly damaging 0.72
IGL02504:Hsd17b14 APN 7 45556375 missense possibly damaging 0.84
IGL03126:Hsd17b14 APN 7 45556079 missense possibly damaging 0.83
IGL03279:Hsd17b14 APN 7 45566193 missense possibly damaging 0.72
IGL03493:Hsd17b14 APN 7 45556091 missense probably damaging 1.00
R0085:Hsd17b14 UTSW 7 45556410 unclassified probably benign
R4128:Hsd17b14 UTSW 7 45563008 missense probably damaging 1.00
R4513:Hsd17b14 UTSW 7 45562915 missense probably benign 0.24
R5903:Hsd17b14 UTSW 7 45565962 missense probably damaging 1.00
R6899:Hsd17b14 UTSW 7 45562928 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGGCCAACAGCAGCTTAATG -3'
(R):5'- CTGCAGGAGAAAGATTTTGGGTC -3'

Sequencing Primer
(F):5'- GCCAACAGCAGCTTAATGAAAAAG -3'
(R):5'- CTTGGACACCAGAGTCTGAG -3'
Posted On2018-07-23