Incidental Mutation 'R6649:Olfr44'
ID527686
Institutional Source Beutler Lab
Gene Symbol Olfr44
Ensembl Gene ENSMUSG00000062649
Gene Nameolfactory receptor 44
SynonymsGA_x6K02T2PVTD-33181773-33180838, MOR171-5, IB3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6649 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39481786-39493995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39484752 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000150827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077757] [ENSMUST00000215065] [ENSMUST00000216316]
Predicted Effect probably benign
Transcript: ENSMUST00000077757
AA Change: V167A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000076935
Gene: ENSMUSG00000062649
AA Change: V167A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4.1e-50 PFAM
Pfam:7tm_1 44 293 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215065
AA Change: V164A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216316
AA Change: V164A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Olfr44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr44 APN 9 39484648 missense probably benign 0.02
IGL02239:Olfr44 APN 9 39484561 missense probably damaging 1.00
IGL02305:Olfr44 APN 9 39485037 missense probably damaging 0.97
IGL02353:Olfr44 APN 9 39485148 missense probably benign
IGL02360:Olfr44 APN 9 39485148 missense probably benign
R0212:Olfr44 UTSW 9 39485088 missense probably damaging 1.00
R0600:Olfr44 UTSW 9 39484988 missense probably benign 0.34
R1329:Olfr44 UTSW 9 39484444 missense probably damaging 0.97
R1348:Olfr44 UTSW 9 39485236 missense probably benign
R1594:Olfr44 UTSW 9 39484746 missense probably benign 0.03
R5017:Olfr44 UTSW 9 39484755 missense possibly damaging 0.90
R5141:Olfr44 UTSW 9 39484531 missense probably damaging 1.00
R5244:Olfr44 UTSW 9 39484512 missense probably damaging 1.00
R5524:Olfr44 UTSW 9 39484987 missense probably damaging 0.97
R5630:Olfr44 UTSW 9 39484951 missense probably benign 0.00
R5860:Olfr44 UTSW 9 39484471 missense probably benign 0.07
R6444:Olfr44 UTSW 9 39484318 missense probably benign 0.04
R6653:Olfr44 UTSW 9 39484752 missense probably benign 0.02
R7115:Olfr44 UTSW 9 39484648 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTTTAGACCTGCCTTCAGTG -3'
(R):5'- TCCTCATATTTGCAATTGCGG -3'

Sequencing Primer
(F):5'- CTGCCTTCAGTGGAGCGAATG -3'
(R):5'- CATATTTGCAATTGCGGAGTGTTAC -3'
Posted On2018-07-23