Incidental Mutation 'R6649:Milr1'
ID527699
Institutional Source Beutler Lab
Gene Symbol Milr1
Ensembl Gene ENSMUSG00000040528
Gene Namemast cell immunoglobulin like receptor 1
SynonymsGm885, Allergin-1, LOC380732
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6649 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106751226-106768794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106757711 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 143 (H143Y)
Ref Sequence ENSEMBL: ENSMUSP00000138617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086353] [ENSMUST00000106794] [ENSMUST00000147326] [ENSMUST00000182023] [ENSMUST00000182479] [ENSMUST00000182896] [ENSMUST00000182908] [ENSMUST00000183111]
Predicted Effect probably benign
Transcript: ENSMUST00000086353
SMART Domains Protein: ENSMUSP00000083538
Gene: ENSMUSG00000040528

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106794
SMART Domains Protein: ENSMUSP00000102406
Gene: ENSMUSG00000040528

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IG 58 139 1.5e-5 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147326
SMART Domains Protein: ENSMUSP00000138742
Gene: ENSMUSG00000040528

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182023
AA Change: H143Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138286
Gene: ENSMUSG00000040528
AA Change: H143Y

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182479
SMART Domains Protein: ENSMUSP00000138386
Gene: ENSMUSG00000040528

DomainStartEndE-ValueType
Blast:IG 1 36 3e-19 BLAST
transmembrane domain 48 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182896
AA Change: H143Y

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000138617
Gene: ENSMUSG00000040528
AA Change: H143Y

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182908
SMART Domains Protein: ENSMUSP00000138678
Gene: ENSMUSG00000040528

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183111
SMART Domains Protein: ENSMUSP00000138513
Gene: ENSMUSG00000040528

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IG 58 139 3.74e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele have decreased mast cell degranulation and an increased susceptibility to type I hypersensitivity reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Milr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Milr1 APN 11 106765245 missense possibly damaging 0.90
IGL02396:Milr1 APN 11 106765239 nonsense probably null
IGL02525:Milr1 APN 11 106765275 missense probably benign 0.01
IGL02620:Milr1 APN 11 106754918 missense probably damaging 0.96
R0010:Milr1 UTSW 11 106767003 makesense probably null
R0240:Milr1 UTSW 11 106754896 nonsense probably null
R0240:Milr1 UTSW 11 106754896 nonsense probably null
R1087:Milr1 UTSW 11 106755022 missense probably damaging 1.00
R4349:Milr1 UTSW 11 106763882 missense possibly damaging 0.91
R5023:Milr1 UTSW 11 106766965 missense possibly damaging 0.90
R5057:Milr1 UTSW 11 106766965 missense possibly damaging 0.90
R5169:Milr1 UTSW 11 106754928 nonsense probably null
R5181:Milr1 UTSW 11 106754980 missense probably damaging 1.00
R6868:Milr1 UTSW 11 106763921 missense probably damaging 1.00
R7008:Milr1 UTSW 11 106751314 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCGATTGCCCTCTAGGTATAG -3'
(R):5'- AGGACCTCAACTAGTGTCCC -3'

Sequencing Primer
(F):5'- CCCTCTAGGTATAGACGATTGGTAC -3'
(R):5'- TCAACTAGTGTCCCCATATAGCTAG -3'
Posted On2018-07-23