Incidental Mutation 'R6649:Papola'
ID527700
Institutional Source Beutler Lab
Gene Symbol Papola
Ensembl Gene ENSMUSG00000021111
Gene Namepoly (A) polymerase alpha
SynonymsPapIII, Plap
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R6649 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location105784694-105838944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105812307 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 315 (I315L)
Ref Sequence ENSEMBL: ENSMUSP00000126275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021535] [ENSMUST00000109901] [ENSMUST00000163473] [ENSMUST00000166329] [ENSMUST00000166735] [ENSMUST00000168186] [ENSMUST00000169938] [ENSMUST00000170002] [ENSMUST00000170540]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021535
AA Change: I315L

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021535
Gene: ENSMUSG00000021111
AA Change: I315L

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.5e-111 PFAM
Pfam:NTP_transf_2 75 175 2.4e-11 PFAM
Pfam:PAP_RNA-bind 366 508 8.9e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109901
AA Change: I315L

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105527
Gene: ENSMUSG00000021111
AA Change: I315L

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
Pfam:PAP_central 21 364 4.1e-120 PFAM
Pfam:NTP_transf_2 82 175 8.1e-16 PFAM
Pfam:PAP_RNA-bind 366 435 4.1e-21 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163473
AA Change: I315L

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131668
Gene: ENSMUSG00000021111
AA Change: I315L

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 9.2e-112 PFAM
Pfam:NTP_transf_2 75 175 3.3e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.6e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163805
Predicted Effect probably benign
Transcript: ENSMUST00000164798
SMART Domains Protein: ENSMUSP00000125898
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 36 5.3e-8 PFAM
Pfam:PAP_RNA-bind 38 106 8.5e-22 PFAM
low complexity region 190 206 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
low complexity region 276 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165584
Predicted Effect probably benign
Transcript: ENSMUST00000166329
SMART Domains Protein: ENSMUSP00000131725
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 99 4.8e-17 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000166471
AA Change: I3L
SMART Domains Protein: ENSMUSP00000132353
Gene: ENSMUSG00000021111
AA Change: I3L

DomainStartEndE-ValueType
Pfam:PAP_central 1 53 9.5e-21 PFAM
Pfam:PAP_RNA-bind 55 123 1.3e-21 PFAM
low complexity region 207 223 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 294 311 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166498
Predicted Effect probably benign
Transcript: ENSMUST00000166735
SMART Domains Protein: ENSMUSP00000128908
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 283 9.4e-73 PFAM
Pfam:NTP_transf_2 72 175 5.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168186
AA Change: I315L

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128402
Gene: ENSMUSG00000021111
AA Change: I315L

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1.1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.6e-11 PFAM
Pfam:PAP_RNA-bind 366 508 5e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 668 N/A INTRINSIC
low complexity region 698 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169524
SMART Domains Protein: ENSMUSP00000130798
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 1 95 5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169938
SMART Domains Protein: ENSMUSP00000130687
Gene: ENSMUSG00000021111

DomainStartEndE-ValueType
Pfam:PAP_central 17 157 4.5e-17 PFAM
Pfam:NTP_transf_2 74 166 2.3e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170002
AA Change: I315L

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126275
Gene: ENSMUSG00000021111
AA Change: I315L

DomainStartEndE-ValueType
Pfam:PAP_central 17 365 1e-111 PFAM
Pfam:NTP_transf_2 75 175 3.5e-11 PFAM
Pfam:PAP_RNA-bind 366 508 4.8e-38 PFAM
low complexity region 518 534 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
low complexity region 605 622 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172040
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the poly(A) polymerase family. It is required for the addition of adenosine residues for the creation of the 3'-poly(A) tail of mRNAs. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Papola
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Papola APN 12 105809597 nonsense probably null
IGL02197:Papola APN 12 105829183 missense possibly damaging 0.90
IGL02511:Papola APN 12 105809345 missense probably damaging 0.99
IGL02608:Papola APN 12 105809559 missense probably damaging 1.00
IGL03081:Papola APN 12 105818855 missense probably damaging 1.00
IGL03378:Papola APN 12 105809433 critical splice donor site probably null
IGL03401:Papola APN 12 105829122 missense probably benign 0.19
R0027:Papola UTSW 12 105833136 missense probably benign 0.12
R0027:Papola UTSW 12 105833136 missense probably benign 0.12
R0325:Papola UTSW 12 105807193 missense probably damaging 1.00
R0372:Papola UTSW 12 105818838 missense probably benign 0.05
R1553:Papola UTSW 12 105820410 missense probably benign 0.30
R1746:Papola UTSW 12 105807209 missense probably benign 0.12
R1954:Papola UTSW 12 105828273 unclassified probably null
R2424:Papola UTSW 12 105827052 missense probably benign 0.02
R4133:Papola UTSW 12 105799658 missense possibly damaging 0.83
R4156:Papola UTSW 12 105800751 critical splice donor site probably null
R4718:Papola UTSW 12 105820448 missense possibly damaging 0.72
R4814:Papola UTSW 12 105799653 missense probably damaging 1.00
R5115:Papola UTSW 12 105826960 missense probably benign 0.08
R5237:Papola UTSW 12 105826960 missense probably benign 0.08
R5372:Papola UTSW 12 105827050 missense probably benign 0.00
R5420:Papola UTSW 12 105806495 missense possibly damaging 0.95
R5430:Papola UTSW 12 105809584 missense probably damaging 1.00
R5831:Papola UTSW 12 105823600 missense probably benign 0.01
R5944:Papola UTSW 12 105812385 missense possibly damaging 0.87
R5956:Papola UTSW 12 105811041 missense probably damaging 1.00
R6143:Papola UTSW 12 105826960 missense probably benign 0.08
R6193:Papola UTSW 12 105820346 missense probably benign 0.42
R6413:Papola UTSW 12 105806504 start gained probably benign
R6490:Papola UTSW 12 105804937 missense probably benign 0.40
R6891:Papola UTSW 12 105809691 unclassified probably benign
R7147:Papola UTSW 12 105808638 start gained probably benign
R7177:Papola UTSW 12 105809531 missense possibly damaging 0.95
R7178:Papola UTSW 12 105807184 missense probably damaging 1.00
R7256:Papola UTSW 12 105809345 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATCTTGGGAACAGACTGTTG -3'
(R):5'- CCCAGTCTGGCAATTCAATTC -3'

Sequencing Primer
(F):5'- AAGCAGTCTCTTGACATGCG -3'
(R):5'- GTCTGGCAATTCAATTCAATCACAC -3'
Posted On2018-07-23