Incidental Mutation 'R6649:Tagap'
ID527711
Institutional Source Beutler Lab
Gene Symbol Tagap
Ensembl Gene ENSMUSG00000033450
Gene NameT cell activation Rho GTPase activating protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R6649 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location7926000-7934897 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7933714 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 577 (V577A)
Ref Sequence ENSEMBL: ENSMUSP00000047431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036370]
Predicted Effect probably benign
Transcript: ENSMUST00000036370
AA Change: V577A

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047431
Gene: ENSMUSG00000033450
AA Change: V577A

DomainStartEndE-ValueType
RhoGAP 98 274 1.16e-35 SMART
low complexity region 350 361 N/A INTRINSIC
low complexity region 459 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160545
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase-activator protein superfamily. The encoded protein may function as a Rho GTPase-activating protein. Alterations in this gene may be associated with several diseases, including rheumatoid arthritis, celiac disease, and multiple sclerosis. Alternate splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Tagap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01554:Tagap APN 17 7932948 missense probably benign 0.01
IGL02589:Tagap APN 17 7933672 missense possibly damaging 0.87
R1750:Tagap UTSW 17 7929910 missense probably benign 0.06
R1791:Tagap UTSW 17 7931467 missense probably damaging 1.00
R1791:Tagap UTSW 17 7933545 missense probably benign 0.04
R2509:Tagap UTSW 17 7928754 missense probably benign 0.00
R4093:Tagap UTSW 17 7929423 missense probably damaging 1.00
R4627:Tagap UTSW 17 7926941 splice site probably null
R4747:Tagap UTSW 17 7932198 missense probably benign
R5222:Tagap UTSW 17 7933641 missense possibly damaging 0.61
R5222:Tagap UTSW 17 7933642 missense possibly damaging 0.92
R5866:Tagap UTSW 17 7933453 missense probably damaging 0.98
R6392:Tagap UTSW 17 7934061 missense probably damaging 0.99
R6638:Tagap UTSW 17 7927074 missense possibly damaging 0.71
R6653:Tagap UTSW 17 7933714 missense probably benign 0.36
R7478:Tagap UTSW 17 7933590 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TAGAAAGCACTCCATGTCGTTTTC -3'
(R):5'- TCCATGGTGAGAAGGCACAG -3'

Sequencing Primer
(F):5'- CCTTTGCGTCTCACAAGAAAGTG -3'
(R):5'- ACAGGGGGCACTGCTGTG -3'
Posted On2018-07-23