Incidental Mutation 'R6649:Jak2'
ID527715
Institutional Source Beutler Lab
Gene Symbol Jak2
Ensembl Gene ENSMUSG00000024789
Gene NameJanus kinase 2
SynonymsC81284
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6649 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location29251828-29313080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29288710 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 517 (I517N)
Ref Sequence ENSEMBL: ENSMUSP00000064394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025705] [ENSMUST00000065796]
Predicted Effect probably benign
Transcript: ENSMUST00000025705
AA Change: I517N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025705
Gene: ENSMUSG00000024789
AA Change: I517N

DomainStartEndE-ValueType
B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065796
AA Change: I517N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064394
Gene: ENSMUSG00000024789
AA Change: I517N

DomainStartEndE-ValueType
B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a protein tyrosine kinase involved in a specific subset of cytokine receptor signaling pathways. It has been found to be constituitively associated with the prolactin receptor and is required for responses to gamma interferon. Mice that do not express an active protein for this gene exhibit embryonic lethality associated with the absence of definitive erythropoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations die during midgestation due to a failure of erythropoieses. Mice expressing a conditional allele activated in mammary tissue exhibit lactation deficiency due to impaired alveologenesis. Mice homozygous for a knock-in allele exhibit myeloproliferative neoplasm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd13a T C 19: 46,367,866 F137L probably damaging Het
Mfsd13a A G 19: 46,372,265 H394R probably benign Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Jak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Jak2 APN 19 29301647 missense probably damaging 1.00
IGL00951:Jak2 APN 19 29299583 missense probably damaging 1.00
IGL01300:Jak2 APN 19 29309683 missense probably damaging 1.00
IGL01800:Jak2 APN 19 29286293 splice site probably benign
IGL02035:Jak2 APN 19 29286408 missense probably benign 0.24
IGL02212:Jak2 APN 19 29287982 missense probably benign 0.01
IGL02447:Jak2 APN 19 29299614 missense probably damaging 1.00
R0001:Jak2 UTSW 19 29282387 missense probably benign 0.01
R0158:Jak2 UTSW 19 29311757 missense probably benign
R0217:Jak2 UTSW 19 29296650 critical splice donor site probably null
R0308:Jak2 UTSW 19 29311757 missense probably benign 0.15
R0344:Jak2 UTSW 19 29283629 missense probably damaging 1.00
R0398:Jak2 UTSW 19 29282388 missense possibly damaging 0.95
R0408:Jak2 UTSW 19 29286317 missense probably benign 0.38
R0453:Jak2 UTSW 19 29311838 missense probably benign 0.01
R0853:Jak2 UTSW 19 29284926 nonsense probably null
R1180:Jak2 UTSW 19 29282499 missense probably damaging 1.00
R1794:Jak2 UTSW 19 29299557 missense probably benign 0.00
R2247:Jak2 UTSW 19 29283636 missense probably benign 0.01
R3908:Jak2 UTSW 19 29291273 missense probably damaging 1.00
R4705:Jak2 UTSW 19 29294915 missense possibly damaging 0.82
R4744:Jak2 UTSW 19 29262256 missense probably benign 0.02
R4814:Jak2 UTSW 19 29301977 missense probably damaging 1.00
R4903:Jak2 UTSW 19 29275036 missense probably benign 0.03
R5602:Jak2 UTSW 19 29298339 missense probably benign 0.01
R5713:Jak2 UTSW 19 29271393 missense probably damaging 0.96
R5740:Jak2 UTSW 19 29262424 missense possibly damaging 0.81
R5758:Jak2 UTSW 19 29309643 missense probably damaging 1.00
R5966:Jak2 UTSW 19 29283554 missense possibly damaging 0.94
R6285:Jak2 UTSW 19 29295659 missense probably benign 0.35
R6439:Jak2 UTSW 19 29309622 synonymous probably null
R6624:Jak2 UTSW 19 29282589 missense probably damaging 0.99
R6653:Jak2 UTSW 19 29288710 missense probably benign 0.00
R7084:Jak2 UTSW 19 29286398 missense possibly damaging 0.78
R7180:Jak2 UTSW 19 29282411 missense probably benign 0.01
R7261:Jak2 UTSW 19 29310985 missense possibly damaging 0.82
X0058:Jak2 UTSW 19 29295711 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCAGCCATTGAGAGATTCTAAG -3'
(R):5'- TGCTGTAAGACTGGCATATTTCCTAAC -3'

Sequencing Primer
(F):5'- GCCATTGAGAGATTCTAAGACACAG -3'
(R):5'- CCACCCAATTATCAAGATTGG -3'
Posted On2018-07-23