Incidental Mutation 'R6649:Mfsd13a'
ID527718
Institutional Source Beutler Lab
Gene Symbol Mfsd13a
Ensembl Gene ENSMUSG00000025227
Gene Namemajor facilitator superfamily domain containing 13a
Synonyms4930538D17Rik, Tmem180, 4930449A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R6649 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location46341121-46375252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46367866 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 137 (F137L)
Ref Sequence ENSEMBL: ENSMUSP00000119072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086969] [ENSMUST00000128041] [ENSMUST00000128455] [ENSMUST00000142994]
Predicted Effect probably damaging
Transcript: ENSMUST00000086969
AA Change: F137L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084189
Gene: ENSMUSG00000025227
AA Change: F137L

DomainStartEndE-ValueType
Pfam:MFS_2 15 441 6.2e-23 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128041
AA Change: F137L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119072
Gene: ENSMUSG00000025227
AA Change: F137L

DomainStartEndE-ValueType
Pfam:MFS_2 9 441 1.1e-26 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137143
Predicted Effect probably damaging
Transcript: ENSMUST00000142994
AA Change: F137L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122944
Gene: ENSMUSG00000025227
AA Change: F137L

DomainStartEndE-ValueType
Pfam:MFS_2 8 318 7.8e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,812,502 H627Q probably benign Het
Abra G A 15: 41,869,233 L146F probably benign Het
Adamts7 T C 9: 90,191,937 C857R probably damaging Het
Ankhd1 A T 18: 36,600,783 probably null Het
Asb15 A G 6: 24,562,633 N198S probably benign Het
Asb16 A T 11: 102,269,037 Q72L possibly damaging Het
Bbox1 G T 2: 110,305,569 H22N probably benign Het
Bcdin3d T C 15: 99,470,815 T168A probably damaging Het
Bmp1 A T 14: 70,490,618 W624R probably damaging Het
C330027C09Rik A T 16: 49,017,466 Q843L probably damaging Het
Cdh18 A T 15: 23,436,534 Y492F possibly damaging Het
Cep290 A C 10: 100,518,531 D848A probably benign Het
Cmya5 G C 13: 93,098,025 S185C possibly damaging Het
Cops9 C T 1: 92,640,414 probably benign Het
Cutal C T 2: 34,885,921 T88I probably benign Het
Dlg4 G T 11: 70,023,953 probably benign Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Erp44 T C 4: 48,205,130 I288V probably null Het
Fam214a T G 9: 75,010,150 L677R probably damaging Het
Fat3 T C 9: 16,376,742 D495G probably damaging Het
Fsip2 T C 2: 82,967,817 V485A possibly damaging Het
Gm14496 A T 2: 181,997,476 H453L possibly damaging Het
Gm17027 T C 14: 42,159,279 T207A unknown Het
Gm6902 T G 7: 23,273,734 T123P possibly damaging Het
Gpat2 T G 2: 127,432,435 W366G possibly damaging Het
Heatr6 A T 11: 83,759,365 T216S probably benign Het
Hsd17b14 T C 7: 45,556,076 V11A probably damaging Het
Jak2 T A 19: 29,288,710 I517N probably benign Het
Kmt5b G A 19: 3,807,295 G351R probably damaging Het
Mau2 G T 8: 70,031,516 Q141K possibly damaging Het
Mfsd14b A T 13: 65,066,785 I451N probably damaging Het
Milr1 C T 11: 106,757,711 H143Y probably benign Het
Mon2 T G 10: 123,038,480 K321T possibly damaging Het
Nlrp9c T A 7: 26,371,322 N945Y probably damaging Het
Nwd2 A G 5: 63,725,184 R60G possibly damaging Het
Olfr30 A T 11: 58,455,568 I127N probably damaging Het
Olfr44 A G 9: 39,484,752 V164A probably benign Het
Olfr691 T C 7: 105,337,707 H3R probably benign Het
Papola A T 12: 105,812,307 I315L possibly damaging Het
Phf3 A T 1: 30,805,023 S1618R possibly damaging Het
Phyhipl A G 10: 70,569,013 F77L probably damaging Het
Ppp3cb A G 14: 20,531,026 L110P probably damaging Het
Prss53 T G 7: 127,886,575 E531A probably benign Het
Raf1 A T 6: 115,631,341 H236Q probably benign Het
Ryr2 A G 13: 11,595,643 V4099A probably damaging Het
Sfxn3 G A 19: 45,049,915 probably null Het
Sh3pxd2b T C 11: 32,415,978 probably null Het
Slco6c1 C T 1: 97,125,711 S155N probably benign Het
Speer4f2 A G 5: 17,375,769 T115A probably benign Het
Spry1 T C 3: 37,642,722 I38T probably damaging Het
Tagap T C 17: 7,933,714 V577A probably benign Het
Ubr4 C A 4: 139,473,624 H4706Q possibly damaging Het
Vmn2r112 T A 17: 22,601,179 L11Q probably null Het
Zfp60 T C 7: 27,748,726 F273S probably benign Het
Zfp938 A T 10: 82,225,398 Y463N probably damaging Het
Other mutations in Mfsd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Mfsd13a APN 19 46366519 missense probably damaging 1.00
IGL01380:Mfsd13a APN 19 46367908 missense probably damaging 1.00
IGL01773:Mfsd13a APN 19 46369294 missense possibly damaging 0.60
IGL02458:Mfsd13a APN 19 46372247 missense probably damaging 1.00
IGL02955:Mfsd13a APN 19 46367753 missense possibly damaging 0.81
R0057:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0113:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0114:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0115:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0361:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0656:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1174:Mfsd13a UTSW 19 46374686 missense probably benign 0.13
R1210:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1251:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R1364:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1365:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1366:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1367:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1692:Mfsd13a UTSW 19 46372076 missense probably benign 0.00
R1852:Mfsd13a UTSW 19 46372180 critical splice acceptor site probably null
R1968:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R2846:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R2985:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3415:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3416:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3431:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3432:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3735:Mfsd13a UTSW 19 46368328 missense probably damaging 1.00
R4393:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4394:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4396:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4920:Mfsd13a UTSW 19 46367216 missense probably damaging 1.00
R5289:Mfsd13a UTSW 19 46368280 missense probably benign 0.00
R5806:Mfsd13a UTSW 19 46366410 missense probably benign 0.01
R6153:Mfsd13a UTSW 19 46367882 missense probably damaging 1.00
R6514:Mfsd13a UTSW 19 46374625 unclassified probably null
R6558:Mfsd13a UTSW 19 46366478 missense probably damaging 1.00
R6649:Mfsd13a UTSW 19 46372265 missense probably benign
R6653:Mfsd13a UTSW 19 46367866 missense probably damaging 0.99
R6911:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
R7022:Mfsd13a UTSW 19 46368324 nonsense probably null
R7334:Mfsd13a UTSW 19 46368370 missense probably damaging 1.00
R7525:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCCCTGGTGTAAAGGTTAC -3'
(R):5'- GCAGCTAGTACCACACAGAAGG -3'

Sequencing Primer
(F):5'- CTGGTGTAAAGGTTACCTCCTAACAC -3'
(R):5'- TAGTACCACACAGAAGGCACGG -3'
Posted On2018-07-23