Incidental Mutation 'R6651:Vmn2r76'
ID527787
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R6651 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86228851 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 446 (N446I)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165771
AA Change: N446I

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: N446I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik A C 7: 43,498,072 S198A possibly damaging Het
Adamts15 A T 9: 30,922,152 I29N probably damaging Het
Ankrd61 A T 5: 143,893,620 I33N probably damaging Het
Arl6ip1 C T 7: 118,129,485 R7H probably benign Het
Atp8a2 A T 14: 59,774,021 D946E probably benign Het
Cc2d2b A T 19: 40,778,129 Q114L probably damaging Het
Ccdc163 T A 4: 116,709,064 S16R possibly damaging Het
Chil6 C T 3: 106,404,260 C68Y probably damaging Het
Cngb3 G T 4: 19,375,231 R287L probably benign Het
Crem C T 18: 3,325,428 R16H probably benign Het
Cyp4f16 C T 17: 32,544,144 R188C probably benign Het
Dap A G 15: 31,273,207 D46G probably damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Enam T C 5: 88,502,917 Y687H probably damaging Het
Fzd4 A T 7: 89,404,802 D39V possibly damaging Het
Ggta1 G T 2: 35,402,294 H334N probably benign Het
Golga3 C T 5: 110,218,130 R1254* probably null Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Helz2 C T 2: 181,239,557 W377* probably null Het
Hfm1 T C 5: 106,847,687 D1286G probably benign Het
Hhatl T C 9: 121,784,702 R425G probably damaging Het
Hivep3 G A 4: 120,122,949 R1728H probably damaging Het
Hyal1 A G 9: 107,579,371 Y419C probably damaging Het
Ighv8-12 A T 12: 115,648,024 D84E possibly damaging Het
Itln1 A G 1: 171,518,372 F271L possibly damaging Het
Klra7 C A 6: 130,229,945 L64F probably benign Het
Kmt2a A T 9: 44,828,811 C1878* probably null Het
Mia2 C A 12: 59,154,362 Q825K possibly damaging Het
Mmp12 C A 9: 7,355,345 P294Q possibly damaging Het
Nedd4 A G 9: 72,731,271 N480S possibly damaging Het
Olfr1255 A T 2: 89,816,896 E190V probably benign Het
Olfr1507 C T 14: 52,490,793 R57Q probably benign Het
Pax6 T A 2: 105,685,830 M151K probably benign Het
Pgm1 A G 5: 64,112,094 Y508C probably benign Het
Ptpn20 T C 14: 33,632,940 F324S probably damaging Het
Recql A G 6: 142,364,434 probably null Het
Rerg A G 6: 137,056,386 V97A probably damaging Het
Rffl C A 11: 82,812,779 C106F probably damaging Het
Scaper T G 9: 55,858,504 N499T probably benign Het
Sfxn3 G A 19: 45,049,915 probably null Het
Slc36a4 A G 9: 15,723,578 S139G probably benign Het
Slco2b1 T A 7: 99,667,169 M385L probably benign Het
Smg8 T C 11: 87,086,546 T70A probably benign Het
Spats2l A T 1: 57,946,177 K463M probably damaging Het
Thbs4 T C 13: 92,756,536 I715V probably benign Het
Tmem234 T A 4: 129,607,471 M113K possibly damaging Het
Vmn2r10 T C 5: 108,995,622 I821V probably null Het
Vmn2r116 A T 17: 23,388,831 K458* probably null Het
Vmn2r95 T A 17: 18,440,360 Y345N probably damaging Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0662:Vmn2r76 UTSW 7 86230370 missense probably benign 0.39
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGCCCAGTCTACCAATTC -3'
(R):5'- TTCAGTCCAGTGATACATGGG -3'

Sequencing Primer
(F):5'- CCTCATACATAAGCAATTCTTGAGG -3'
(R):5'- CAGTCCAGTGATACATGGGAATTTC -3'
Posted On2018-07-23