Incidental Mutation 'R6689:Cyr61'
ID527884
Institutional Source Beutler Lab
Gene Symbol Cyr61
Ensembl Gene ENSMUSG00000028195
Gene Namecysteine rich protein 61
SynonymsCCN1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location145646976-145649981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145647788 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 340 (M340L)
Ref Sequence ENSEMBL: ENSMUSP00000029846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029846]
Predicted Effect probably benign
Transcript: ENSMUST00000029846
AA Change: M340L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029846
Gene: ENSMUSG00000028195
AA Change: M340L

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
IB 24 93 1.16e-24 SMART
VWC 100 163 9.94e-23 SMART
low complexity region 164 184 N/A INTRINSIC
TSP1 229 271 1.34e-5 SMART
CT 289 358 3.74e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197148
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011]
PHENOTYPE: Targeted null mice die pre- or perinatally, and none survive beyond 24 hrs of birth. About 30% of embryos die by E10.5 from defects in chorioallantoic fusion, whereas 70% die from placental vascular defects, including impaired allantoic vessel bifurcation, and loss of large-vessel integrity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,589,109 probably null Het
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Commd6 C A 14: 101,640,459 probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in Cyr61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cyr61 APN 3 145648610 missense probably damaging 0.96
IGL02500:Cyr61 APN 3 145648700 missense probably damaging 1.00
IGL02963:Cyr61 APN 3 145647875 missense probably damaging 1.00
IGL03170:Cyr61 APN 3 145649759 missense probably benign 0.01
R0018:Cyr61 UTSW 3 145649431 missense probably damaging 0.99
R0846:Cyr61 UTSW 3 145647770 missense possibly damaging 0.94
R0964:Cyr61 UTSW 3 145647748 missense probably damaging 1.00
R1234:Cyr61 UTSW 3 145649839 start gained probably benign
R1968:Cyr61 UTSW 3 145648210 missense probably damaging 0.99
R1989:Cyr61 UTSW 3 145647743 missense probably benign 0.31
R2071:Cyr61 UTSW 3 145648673 nonsense probably null
R5622:Cyr61 UTSW 3 145649320 missense probably damaging 1.00
R5639:Cyr61 UTSW 3 145648697 missense probably damaging 1.00
R5734:Cyr61 UTSW 3 145648268 missense probably damaging 1.00
R5792:Cyr61 UTSW 3 145648658 missense probably benign
R6129:Cyr61 UTSW 3 145649231 missense possibly damaging 0.85
R7131:Cyr61 UTSW 3 145648781 missense probably damaging 1.00
R7289:Cyr61 UTSW 3 145648673 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAAGGCACCATTCATCCTC -3'
(R):5'- TTTCTTCCAGAAGGGCAAGAAATG -3'

Sequencing Primer
(F):5'- ACGTCTCCATGATGCTTGCG -3'
(R):5'- GAAATGCAGCAAGACCAAGAAATC -3'
Posted On2018-07-23