Incidental Mutation 'R6689:4921507P07Rik'
List |< first << previous [record 54 of 9592] next >> last >|
ID527886
Institutional Source Beutler Lab
Gene Symbol 4921507P07Rik
Ensembl Gene ENSMUSG00000029828
Gene NameRIKEN cDNA 4921507P07 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6689 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location50573302-50596632 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 50589109 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031852]
Predicted Effect probably null
Transcript: ENSMUST00000031852
SMART Domains Protein: ENSMUSP00000031852
Gene: ENSMUSG00000029828

DomainStartEndE-ValueType
Pfam:DUF4555 1 283 2e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147260
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankk1 T A 9: 49,420,476 I173F probably damaging Het
Aurka A G 2: 172,370,393 probably null Het
B4galnt4 C T 7: 141,067,984 T471I probably benign Het
Commd6 C A 14: 101,640,459 probably benign Het
Cyr61 T A 3: 145,647,788 M340L probably benign Het
Elobl T C 11: 88,965,093 N48S possibly damaging Het
Grem1 T C 2: 113,749,931 E75G probably benign Het
Hp C T 8: 109,575,720 V199I probably benign Het
Kcna2 C A 3: 107,105,027 S308Y probably damaging Het
Lgr5 T A 10: 115,466,608 I293F probably damaging Het
Lmln A G 16: 33,104,782 R462G probably benign Het
Lsm3 GATATATA GATATATATA 6: 91,519,635 probably null Het
Mroh4 A G 15: 74,612,003 V495A probably damaging Het
Olfr1100 A G 2: 86,978,154 I214T probably benign Het
Olfr95 C G 17: 37,211,157 G232A probably damaging Het
Stim2 G A 5: 54,115,976 R524H probably damaging Het
Other mutations in 4921507P07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:4921507P07Rik APN 6 50589184 critical splice acceptor site probably null
IGL01310:4921507P07Rik APN 6 50574195 missense probably benign
IGL01568:4921507P07Rik APN 6 50573698 utr 3 prime probably benign
IGL01794:4921507P07Rik APN 6 50577846 missense probably damaging 1.00
IGL02718:4921507P07Rik APN 6 50584387 missense probably damaging 1.00
IGL03146:4921507P07Rik APN 6 50573873 missense probably damaging 0.97
IGL03381:4921507P07Rik APN 6 50589136 missense probably damaging 1.00
R1173:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1174:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1175:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1769:4921507P07Rik UTSW 6 50591821 splice site probably benign
R1883:4921507P07Rik UTSW 6 50574453 missense probably benign 0.01
R2056:4921507P07Rik UTSW 6 50573745 missense possibly damaging 0.71
R2437:4921507P07Rik UTSW 6 50583979 missense probably damaging 1.00
R2929:4921507P07Rik UTSW 6 50574305 missense probably benign 0.07
R4357:4921507P07Rik UTSW 6 50574210 missense probably benign
R4666:4921507P07Rik UTSW 6 50595828 missense possibly damaging 0.69
R4791:4921507P07Rik UTSW 6 50595837 missense probably damaging 1.00
R4827:4921507P07Rik UTSW 6 50595856 missense possibly damaging 0.76
R4976:4921507P07Rik UTSW 6 50589184 critical splice acceptor site probably null
R5453:4921507P07Rik UTSW 6 50595796 critical splice donor site probably null
R6897:4921507P07Rik UTSW 6 50589165 missense possibly damaging 0.82
X0021:4921507P07Rik UTSW 6 50573926 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGAGCCTGTTTGGTTTG -3'
(R):5'- GCCTGTTTAGGGAAAACTTCTTAC -3'

Sequencing Primer
(F):5'- GTTTGTTTCCATTTGCTTAGTGC -3'
(R):5'- ATGCTCTCTGTAGAAGCTCTGTATAG -3'
Posted On2018-07-23