Incidental Mutation 'R6265:Ccdc24'
ID527954
Institutional Source Beutler Lab
Gene Symbol Ccdc24
Ensembl Gene ENSMUSG00000078588
Gene Namecoiled-coil domain containing 24
SynonymsLOC381546
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6265 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117866524-117872557 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 117871177 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 47 (Q47*)
Ref Sequence ENSEMBL: ENSMUSP00000131215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030266] [ENSMUST00000030269] [ENSMUST00000063857] [ENSMUST00000084325] [ENSMUST00000106421] [ENSMUST00000106422] [ENSMUST00000131938] [ENSMUST00000149168] [ENSMUST00000163288] [ENSMUST00000164853] [ENSMUST00000166325] [ENSMUST00000167287] [ENSMUST00000167443] [ENSMUST00000169885] [ENSMUST00000171052]
Predicted Effect probably benign
Transcript: ENSMUST00000030266
SMART Domains Protein: ENSMUSP00000030266
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 228 4.2e-59 PFAM
Pfam:Glyco_transf_7C 232 310 2.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030269
SMART Domains Protein: ENSMUSP00000030269
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063857
SMART Domains Protein: ENSMUSP00000066102
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084325
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106421
SMART Domains Protein: ENSMUSP00000102029
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect silent
Transcript: ENSMUST00000106422
SMART Domains Protein: ENSMUSP00000102030
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130758
Predicted Effect probably null
Transcript: ENSMUST00000131938
AA Change: Q47*
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154439
Predicted Effect probably benign
Transcript: ENSMUST00000163288
SMART Domains Protein: ENSMUSP00000127289
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 46 566 2.1e-212 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164716
Predicted Effect silent
Transcript: ENSMUST00000164853
SMART Domains Protein: ENSMUSP00000132114
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000166325
SMART Domains Protein: ENSMUSP00000131493
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 33 57 N/A INTRINSIC
low complexity region 61 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167287
SMART Domains Protein: ENSMUSP00000126161
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
coiled coil region 13 38 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167443
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169885
SMART Domains Protein: ENSMUSP00000127093
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 1 450 1.2e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170733
Predicted Effect probably benign
Transcript: ENSMUST00000171052
SMART Domains Protein: ENSMUSP00000129502
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
Pfam:CCDC24 21 201 3.9e-67 PFAM
low complexity region 282 294 N/A INTRINSIC
Meta Mutation Damage Score 0.6204 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik C T 4: 137,454,675 P47L probably damaging Het
Acot1 T C 12: 84,016,913 I265T probably benign Het
Amotl1 T C 9: 14,571,655 D587G possibly damaging Het
Anks1b T G 10: 90,941,500 D1117E probably damaging Het
Art4 T G 6: 136,854,888 N85T probably damaging Het
Asb3 C A 11: 31,085,143 Q462K probably benign Het
Atcay C T 10: 81,213,280 E163K possibly damaging Het
Atp6v0e T C 17: 26,676,533 V20A possibly damaging Het
Atp7b G A 8: 22,015,927 Q520* probably null Het
Baat A T 4: 49,502,836 D95E possibly damaging Het
Cars2 TCCCC TCCC 8: 11,529,599 probably null Het
Cep170b C A 12: 112,744,559 Q1488K probably damaging Het
Cldn24 A C 8: 47,822,339 D66A probably benign Het
Cln5 C A 14: 103,073,227 T110K probably damaging Het
Clvs2 C A 10: 33,528,515 S235I possibly damaging Het
Col5a3 C T 9: 20,793,764 G730R unknown Het
Crim1 C T 17: 78,370,085 P905L probably benign Het
Cxxc4 T C 3: 134,258,063 V356A probably benign Het
Dctn6 G T 8: 34,094,903 N93K probably damaging Het
Dnah9 G A 11: 66,168,094 A125V probably benign Het
Dnhd1 T C 7: 105,693,370 I1307T probably benign Het
Dpy19l1 T A 9: 24,432,371 I493F possibly damaging Het
Ebf2 A G 14: 67,424,060 I546V probably benign Het
Fbll1 T C 11: 35,797,809 E209G probably damaging Het
Foxj2 G A 6: 122,828,174 A2T probably damaging Het
Foxs1 A T 2: 152,932,178 C318* probably null Het
Gorab T C 1: 163,386,630 T244A possibly damaging Het
Gtsf1l C A 2: 163,087,663 probably benign Het
Herc1 T C 9: 66,372,016 S69P probably benign Het
Hpca C T 4: 129,118,652 W30* probably null Het
Ing3 C A 6: 21,953,814 Q85K probably damaging Het
Klhdc8b T C 9: 108,448,425 E264G probably damaging Het
Lair1 T A 7: 4,055,827 probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lamtor2 C A 3: 88,550,713 G29* probably null Het
Loxhd1 A T 18: 77,361,730 D341V probably damaging Het
Lrp2 T A 2: 69,466,340 D3290V probably damaging Het
Matn2 A T 15: 34,399,155 D396V probably damaging Het
Me3 T A 7: 89,849,743 D510E probably benign Het
Melk A G 4: 44,318,109 Y170C probably damaging Het
Mgat2 T C 12: 69,184,793 V47A probably benign Het
Mindy4 T C 6: 55,301,064 I631T probably damaging Het
Myo5b T A 18: 74,577,440 probably null Het
Myo7b A T 18: 31,998,150 D521E probably damaging Het
Nlrp9b T A 7: 20,062,683 F986I probably benign Het
Olfr1089 A G 2: 86,732,955 L219P probably damaging Het
Patj A G 4: 98,469,567 D690G probably benign Het
Pias2 T C 18: 77,097,258 S5P probably damaging Het
Reep4 A T 14: 70,547,703 S150C probably damaging Het
Slc25a21 T C 12: 57,196,900 R14G probably benign Het
Slc6a6 G C 6: 91,754,915 R575T probably damaging Het
Speg T A 1: 75,406,679 Y886* probably null Het
Tas2r103 A C 6: 133,036,531 F191V probably damaging Het
Tbc1d19 A G 5: 53,837,924 D145G probably benign Het
Tex47 T A 5: 7,305,461 I214N probably damaging Het
Tnnt3 A T 7: 142,501,645 D3V probably damaging Het
Trdv2-1 T G 14: 53,946,385 S24A probably benign Het
Ubr4 A G 4: 139,452,640 D3377G possibly damaging Het
Ugt3a2 A T 15: 9,361,579 D147V probably damaging Het
Usp9y A T Y: 1,446,843 D103E probably benign Homo
Vmn1r168 A G 7: 23,541,536 I273V probably benign Het
Vmn2r61 T C 7: 42,266,491 I176T probably benign Het
Vmn2r8 T A 5: 108,808,597 D53V probably benign Het
Zbtb8os A T 4: 129,335,982 probably benign Het
Zfp551 C T 7: 12,415,412 R690Q probably damaging Het
Other mutations in Ccdc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Ccdc24 APN 4 117872046 missense probably damaging 1.00
IGL02396:Ccdc24 APN 4 117869629 missense possibly damaging 0.91
IGL03122:Ccdc24 APN 4 117871745 critical splice donor site probably null
R1473:Ccdc24 UTSW 4 117869904 splice site probably benign
R1488:Ccdc24 UTSW 4 117870568 missense possibly damaging 0.88
R1986:Ccdc24 UTSW 4 117872016 missense probably damaging 1.00
R2233:Ccdc24 UTSW 4 117869916 missense possibly damaging 0.53
R4983:Ccdc24 UTSW 4 117872100 missense probably benign 0.06
R5250:Ccdc24 UTSW 4 117869629 missense possibly damaging 0.91
R5677:Ccdc24 UTSW 4 117869880 intron probably benign
R6092:Ccdc24 UTSW 4 117872448 nonsense probably null
R6284:Ccdc24 UTSW 4 117869653 unclassified probably null
R6736:Ccdc24 UTSW 4 117870535 missense possibly damaging 0.81
R6814:Ccdc24 UTSW 4 117869926 missense probably benign 0.02
R6872:Ccdc24 UTSW 4 117869926 missense probably benign 0.02
R7016:Ccdc24 UTSW 4 117871116 missense probably null 1.00
R7073:Ccdc24 UTSW 4 117872004 missense probably damaging 1.00
Z1088:Ccdc24 UTSW 4 117871063 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACTACCCCTTTCTGGCAG -3'
(R):5'- TGCACAAGTATACTGTGCCAG -3'

Sequencing Primer
(F):5'- GCAGTCCCAGCCCCTTAATTTC -3'
(R):5'- TATAAGCTGAGCATTGTCCCCAG -3'
Posted On2018-07-23